Skip to main content Skip to navigation
Oligo Mouse Anti-Human Her2/Neu

BD™ AbSeq Oligo Mouse Anti-Human Her2/Neu

Clone NEU 24.7

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
HER2; NEU; ERBB2; p185HER2; erb-b2 receptor tyrosine kinase 2; CD340
2064
2 µl
Mouse BALB/c IgG1
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGTGTCTCGGTGGTATTAGTAGCTCGCGTATTATCT
AHS0152
SKBR3 human breast carcinoma cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu HER2/NEU Olgo AHS0152 NEU 24.7 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940238 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
NEU 24.7

The Neu 24.7 monoclonal antibody specifically recognizes HER-2/neu, which is also known as p185HER2 or CD340. HER-2/neu is a ~185 kDa type I transmembrane glycoprotein that is encoded by ERBB2 (erb-b2 receptor tyrosine kinase 2) which belongs to the ERBB receptor kinase family. The HER-2/neu antigen is expressed on some breast cancer cells. Amplification and/or over expression of HER-2/neu occurs in multiple human malignancies. Overexpression is reported to be strongly correlated with progression of human ovarian and breast carcinomas. Anti-HER-2/neu stains the external domain of this protein on cells such as the strongly expressing line SKBR3 and the weakly expressing line MCF7. HER-2/neu is also expressed on normal bone marrow mesenchymal stem cells (MSC).

940238 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940238 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (5)

  1. Fendly BM, Kotts C, Vetterlein D, et al. The extracellular domain of HER2/neu is a potential immunogen for active specific immunotherapy of breast cancer.. J Biol Response Mod. 1990; 9(5):449-55. (Biology). 참조 보기
  2. Gullick WJ. The role of the epidermal growth factor receptor and the c-erbB-2 protein in breast cancer.. Int J Cancer Suppl. 1990; 5:55-61. (Biology). 참조 보기
  3. Shalaby MR, Shepard HM, Presta L, et al. Development of humanized bispecific antibodies reactive with cytotoxic lymphocytes and tumor cells overexpressing the HER2 protooncogene.. J Exp Med. 1992; 175(1):217-25. (Biology). 참조 보기
  4. Stancovski I, Hurwitz E, Leitner O, Ullrich A, Yarden Y, Sela M. Mechanistic aspects of the opposing effects of monoclonal antibodies to the ERBB2 receptor on tumor growth.. Proc Natl Acad Sci USA. 1991; 88(19):8691-5. (Immunogen: Immunoprecipitation, Radioimmunoassay). 참조 보기
  5. Szollosi J, Balazs M, Feuerstein BG, Benz CC, Waldman FM. ERBB-2 (HER2/neu) gene copy number, p185HER-2 overexpression, and intratumor heterogeneity in human breast cancer. Cancer Res. 1995; 55(22):5400-5407. (Biology). 참조 보기
940238 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.