Skip to main content Skip to navigation
Oligo Mouse Anti-Human EGF Receptor

BD™ AbSeq Oligo Mouse Anti-Human EGF Receptor

Clone EMab-134 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
EGFR; ERBB; ERBB1; HER1; mENA; PIG61
1956
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATCATCATCGTATTATCAGTGCTATTCGGTTGTGCG
AHS0267
Human EGF Receptor extracellular domain Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940502 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
EMab-134

The EMab-134 monoclonal antibody specifically recognizes the epidermal growth factor receptor (EGF-R). The EGF-R is a transmembrane glycoprotein of approximately 170 kDa that is expressed on most cells. It consists of a glycosylated extracellular domain which binds to epidermal growth factor (EGF), a transmembrane domain, and an intracellular domain with tyrosine-kinase activity essential for signal transduction. The epitope recognized by EMab-134 is an extracellular peptide that is not affected by glycosylation. The EGF-R plays an important role in the growth and differentiation of many cellular types. Transforming growth factor α (TGFα), vaccinia virus growth factor, and related growth factors can also bind to and signal through the EGF-R.

940502 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940502 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940502" on CiteAb

개발 참고 자료 (5)

  1. Itai S, Yamada S, Kaneko MK, Chang YW, Harada H, Kato Y. Establishment of EMab-134, a Sensitive and Specific Anti-Epidermal Growth Factor Receptor Monoclonal Antibody for Detecting Squamous Cell Carcinoma Cells of the Oral Cavity. Monoclon Antib Immunodiagn Immunother. 2017; 36(6):272-281. (Immunogen: ELISA, Flow cytometry, Immunohistochemistry, Western blot). 참조 보기
  2. Kaneko MK, Yamada S, Itai S, et al. Elucidation of the critical epitope of an anti-EGFR monoclonal antibody EMab-134.. Biochem Biophys Rep. 2018; 14:54-57. (Clone-specific: Flow cytometry, Immunohistochemistry, Western blot). 참조 보기
  3. Kovacs E, Zorn JA, Huang Y, Barros T, Kuriyan J. A structural perspective on the regulation of the epidermal growth factor receptor.. Annu Rev Biochem. 2015; 84:739-64. (Biology). 참조 보기
  4. Leahy DJ. Structure and function of the epidermal growth factor (EGF/ErbB) family of receptors.. Adv Protein Chem. 2004; 68:1-27. (Biology). 참조 보기
  5. Messa C, Russo F, Notarnicola M, Di Leo A. Demonstration of epidermal growth factor receptor in colorectal adenocarcinoma by enzyme immunoassay. Digestion. 1994; 55(2):103-107. (Biology). 참조 보기
940502 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.