Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD85j

BD™ AbSeq Oligo Mouse Anti-Human CD85j

Clone GHI/75

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
ILT-2; ILT2; LILRB1; LIR-1; LIR1; MIR-7; MIR7; PIR-B; PIRB; leucocyte Ig-like receptor B1; leukocyte immunoglobulin-like receptor subfamily B member 1
10859
2 µl
Mouse IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGCTACGGGACATGGACGATATTACGATTGGAAAGG
AHS0163
Human Hairy Cell Leukemia Spleen Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD85J Olgo AHS0163 GHI/75 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940249 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
GHI/75

CD85 molecules belong to a large immunoregulatory family and it has been clustered into different subclasses from CD85a to CD85m in the VIIth HLDA workshop. CD85j is also called as Ig-like transcript (ILT2), or leukocyte Ig-like receptor (LIR-1). Reacts with an 110 kDa membrane glycoprotein expressed on a subset of NK cells, which varies amongst individuals, and a subpopulation of T lymphocytes. Expression on T lymphocytes, NK cells may depend on  the individuals tested. Function studies show that ligation of ILT2 with MHC class I including HLA-A, B, G1 and -E induces an inhibitory signal via recruitment of SHP-1 phosphatase.

940249 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940249 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (8)

  1. Banham AH, Colonna M, Cella M, et al. Identification of the CD85 antigen as ILT2, an inhibitory MHC class I receptor of the immunoglobulin superfamily.. J Leukoc Biol. 1999; 65(6):841-5. (Immunogen: Flow cytometry, Immunoaffinity chromatography, Immunohistochemistry). 참조 보기
  2. Colonna M, Nakajima H, Navarro F, Lopez-Botet M. A novel family of Ig-like receptors for HLA class I molecules that modulate function of lymphoid and myeloid cells. J Leukoc Biol. 1999; 66(3):375-381. (Biology). 참조 보기
  3. Colonna M, Navarro F, Bellon T, et al. A common inhibitory receptor for major histocompatibility complex class I molecules on human lymphoid and myelomonocytic cells. J Exp Med. 1997; 186(11):1809-1818. (Biology). 참조 보기
  4. Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002.
  5. McArdle JP, Knight BA, Halliday GM, Muller HK, Rowden G. Quantitative assessment of Langerhans cells in actinic keratosis, Bowen's disease, keratoacanthoma, squamous cell carcinoma and basal cell carcinoma. Pathology. 1986; 18(2):212-216. (Biology). 참조 보기
  6. Pulford K, Jones M, Moldenhauer G, Zola H and Mason DY. CD85 workshop panel report. In: Kishmoto T, ed. Leukocyte Typing VI. New York: Garland Publishing; 1997:196-198.
  7. Pulford K, Micklem K, Thomas J, Jones M, Mason DY. A 72-kD B cell-associated surface glycoprotein expressed at high levels in hairy cell leukaemia and plasma cell neoplasms. Clin Exp Immunol. 1991; 85(3):429-435. (Biology). 참조 보기
  8. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
모두 보기 (8) 간단히 보기
940249 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.