Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD73

BD™ AbSeq Oligo Mouse Anti-Human CD73

Clone AD2

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
NT5E; 5' nucleotidase; 5'-NT; E5NT; Ecto-5'-nucleotidase; eN; eNT; NT; NT5
4907
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAAGTAGGGTCGATCAAGGGAGTTAACGGTAGCGCT
AHS0216
Pre-B leukemia cell line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD73 Olgo AHS0216 AD2 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940294 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
AD2

The AD2 monoclonal antibody specifically binds to ecto-5'-nucleotidase, a 70 kDa, glycosyl phosphatidylinositol (GPI)-anchored glycoprotein. CD73 is expressed on subsets of T and B lymphocytes, follicular dendritic cells, epithelial cells, endothelial cells and mesenchymal stem cells. Its expression on lymphocytes increases during T and B cell development. CD73 has enzymatic activity and catalyzes the dephosphorylation of adenosine monophosphate (AMP) converting it to adenosine. It has been suggested that CD73 can mediate costimulatory signals in T cell activation and adhesion of lymphocytes to endothelium.

940294 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940294 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (6)

  1. Alam MS, Kurtz CC, Rowlett RM, et al. CD73 is expressed by human regulatory T helper cells and suppresses proinflammatory cytokine production and Helicobacter felis-induced gastritis in mice. J Infect Dis. 2009; 199(4):494-504. (Biology). 참조 보기
  2. Dörken B, Möller P, Pezzutto R, Schwartz-Albiez R, Moldenhauer G. B-cell antigens: CD73. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:102-104.
  3. Nakamura T, Kubagawa H, Ohno T, Cooper MD. Characterization of an IgM Fc-binding receptor on human T cells. J Immunol. 1993; 151(12):6933-6941. (Clone-specific). 참조 보기
  4. Salazar-Gonzalez JF, Moody DJ, Giorgi JV, Martinez-Maza O, Mitsuyasu RT, Fahey JL. Reduced ecto-5'-nucleotidase activity and enhanced OKT10 and HLA-DR expression on CD8 (T suppressor/cytotoxic) lymphocytes in the acquired immune deficiency syndrome: evidence of CD8 cell immaturity. J Immunol. 1985; 135(3):1778-1785. (Biology). 참조 보기
  5. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  6. Thomson LF, Ruedi JM, Glass A, et al. Production and characterization of monoclonal antibodies to the glycosyl phosphatidylinositol-anchored lymphocyte differentiation antigen ecto-5'-nucleotidase (CD73). Tissue Antigens. 1990; 35(1):9-19. (Biology). 참조 보기
모두 보기 (6) 간단히 보기
940294 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.