Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD49a

BD™ AbSeq Oligo Mouse Anti-Human CD49a

Clone SR84

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Integrin α1; Integrin alpha-1; ITGA1; ITA1; VLA-1; VLA1
3672
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATGACACGAATGCGACGAGAGGCGAAATAGGTTGGT
AHS0101
P-Selectin IgG1 Fusion
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD49a Olgo AHS0101 SR84 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940094 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
SR84

The SR84 monoclonal antibody specifically recognizes CD49a (CD49 antigen-like family member A). CD49a is a ~200 kDa type I transmembrane molecule that is encoded by ITGA1 (Integrin subunit alpha 1). CD49a is also known as very late antigen 1α subunit (VLA-1) of the integrin family of cell adhesion molecules. CD49a associates with the integrin β1 subunit (CD29) to form the α1/β1 heterodimer (CD49a/CD29), and serves as receptor for collagen and laminin-1. It is expressed on activated T cells, monocytes, neuronal cells and smooth muscle cells. CD49a has been reported to play a role in cell attachment during the development of both the central and peripheral nervous systems.

940094 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940094 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (4)

  1. Barclay NA, Brown MH, Birkeland ML, et al, ed. The Leukocyte Antigen FactsBook. San Diego, CA: Academic Press; 1997.
  2. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  3. Rettig WJ, Dracopoli NC, Goetzger TA, et al. Somatic cell genetic analysis of human cell surface antigens: chromosomal assignments and regulation of expression in rodent-human hybrid cells.. Proc Natl Acad Sci USA. 1984; 81(20):6437-41. (Immunogen: Immunoprecipitation). 참조 보기
  4. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
940094 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.