Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD44

BD™ AbSeq Oligo Mouse Anti-Human CD44

Clone 515

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Pgp-1; CSPG8; ECMR-III; Epican; H-CAM; HCELL; Hermes; HUTCH-1
960
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGTATTGTGAGCGAGCGTTGGCGTAGTTAGAGGATG
AHS0140
Human EBV-transformed Arent B Lymphoblastoid Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD44 Olgo AHS0140 515 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940364 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
515

The 515 monoclonal antibody specifically binds to CD44. CD44 is an 80-95 kDa type I transmembrane glycoprotein, also known as Phagocytic glycoprotein-1 (Pgp-1), or Extracellular matrix receptor type III (ECMR-III). CD44 is a member of the hyaladherin family of hyaluronan-binding proteins, with structural similarities to selectins. CD44 is the receptor for hyaluronic acid. CD44 is expressed on leucocytes, erythrocytes, epithelial cells and weakly on platelets. CD44 has functional roles in cell migration, lymphocyte homing and adhesion during hematopoiesis and lymphocyte activation. The 515 monoclonal antibody can reportedly block cellular adhesion to hyaluronic acid.

940364 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940364 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (4)

  1. Kansas GS, Muirhead MJ, Dailey MO. Expression of the CD11/CD18, leukocyte adhesion molecule 1, and CD44 adhesion molecules during normal myeloid and erythroid differentiation in humans. Blood. 1990; 76(12):2483-2492. (Clone-specific: Flow cytometry). 참조 보기
  2. Kansas GS, Tedder TF. Transmembrane signals generated through MHC class II, CD19, CD20, CD39, and CD40 antigens induce LFA-1-dependent and independent adhesion in human B cells through a tyrosine kinase-dependent pathway. J Immunol. 1991; 147(12):4094-4102. (Clone-specific: Functional assay). 참조 보기
  3. Kansas GS, Wood GS, Dailey MO. A family of cell-surface glycoproteins defined by a putative anti-endothelial cell receptor antibody in man.. J Immunol. 1989; 142(9):3050-7. (Immunogen: Blocking, Flow cytometry, Immunohistochemistry, Immunoprecipitation, Radioimmunoassay). 참조 보기
  4. Patel DD, Liao HX, Haynes BF. CD44 workshop panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:373-375.
940364 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.