Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD42b

BD™ AbSeq Oligo Mouse Anti-Human CD42b

Clone HIP1 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
GP1BA; GPIbalpha; GP-Ib alpha; GPIb-alpha; CD42b-alpha; Glycocalicin; BSS
2811
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTGTATTGAGGTTAGCGTAGTTCGTAGGTGTGCGGG
AHS0186
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940268 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
HIP1

The HIP1 monoclonal antibody specifically binds to CD42b. CD42b is also known as the Platelet glycoprotein Ib alpha chain that is encoded by the GP1BA gene. CD42b is disulfide bonded to CD42c to form a 170 kDa heterodimer, GPIb. GPIb forms a noncovalent complex with CD42a and CD42d (CD42 complex) that is expressed on platelets and megakaryocytes. The CD42 complex serves as the von Willebrand Factor  (vWF) surface receptor involved in the adhesion of platelets to the subendothelium of damaged vascular walls. HIP1 inhibits the ristocetin-dependent binding of  vWF to platelets and partially inhibits collagen-induced aggregation.

940268 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940268 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940268" on CiteAb

개발 참고 자료 (4)

  1. George NP, Wei Q, Shin PK, Konstantopoulos K, Ross JM. Staphylococcus aureus adhesion via Spa, ClfA, and SdrCDE to immobilized platelets demonstrates shear-dependent behavior. Arterioscler Thromb Vasc Biol. 2006; 26(10):2394-2400. (Clone-specific: Functional assay). 참조 보기
  2. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  3. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  4. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
940268 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.