Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD41a

BD™ AbSeq Oligo Mouse Anti-Human CD41a

Clone HIP8

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
ITGA2B; Integrin alpha-2b (αIIb); Platelet glycoprotein IIb (GPIIb)
3674
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGAATATGGTCCGTCGCGAAGATCCGTAAGGTGTTT
AHS0128
Purified platelet membrane glycoproteins
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD41a Olgo AHS0128 HIP8 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940219 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
HIP8

The HIP8 monoclonal antibody specifically binds to the α-chain of CD41. CD41 is also known as Integrin αIIb or Platelet GPIIb. The calcium-dependent complex of CD41 and CD61 (β3 integrin or GPIIIa) is normally expressed on platelets and megakaryocytes. The CD41/CD61 complex is the receptor for fibrinogen, fibronectin and von Willebrand factor, and mediates platelet adhesion and aggregation. CD41 (clone HIP8) completely inhibits ADP-, epinephrine-, and collagen-induced platelet activation, and partially inhibits ristocetin- and thrombin-induced platelet activation. This antibody is useful in the morphological and physiological studies of platelets and megakaryocytes.

940219 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940219 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (2)

  1. von dem Borne AEGKr, Modderman PW, Admiraal LG, Nieuwenhuis, HK. Platelet antibodies, the overall results. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:951-966.
  2. von dem Borne AEGKr, Modderman PW. Cluster report: CD41. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:997-999.
940219 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.