Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD36

BD™ AbSeq Oligo Mouse Anti-Human CD36

Clone CLB-IVC7 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
GPIIIb; GPIV; OKM-5; PASIV; FAT; SCARB3
948
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AATTGTAGTAGTCCGGTGTATGTAGAGTAGGCGTTT
AHS0135
Human Monocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940224 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
CLB-IVC7

The CLB-IVC7 monoclonal antibody specifically binds to CD36 which is also known as Glycoprotein IIIb (GPIIIb, GP3B), Platelet glycoprotein IV (GPIV), Fatty acid translocase (FAT), Platelet collagen receptor (PASIV), Scavenger receptor class B member 3 (SCARB3) or Thrombospondin receptor. CD36 is a ~88 kDa transmembrane that belongs to the scavenger receptor superfamily. The CD36 antigen is expressed on platelets, megakaryocytes, monocytes, macrophages, dendritic cells, erythroid precursors, adipocytes, and some endothelial and epithelial cells. The CD36 antigen is the receptor for extracellular matrix proteins such as collagen and thrombospondin. The CD36 antigen can mediate the adhesion of erythrocytes infected with the human malaria parasite, Plasmodium falciparum. The CD36 antigen functions as a scavenger receptor in macrophages.

940224 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940224 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940224" on CiteAb

개발 참고 자료 (7)

  1. Greenwalt DE, Lipsky RH, Ockenhouse CF, Ikeda H, Tandon NN, Jamieson GA. Membrane glycoprotein CD36: a review of its roles in adherence, signal transduction, and transfusion medicine.. Blood. 1992; 80(5):1105-15. (Biology). 참조 보기
  2. Handunnetti SM, van Schravendijk MR, Hasler T, Barnwell JW, Greenwalt DE, Howard RJ. Involvement of CD36 on erythrocytes as a rosetting receptor for Plasmodium falciparum-infected erythrocytes.. Blood. 1992; 80(8):2097-104. (Biology). 참조 보기
  3. Ockenhouse CF, Magowan C, Chulay JD. Activation of monocytes and platelets by monoclonal antibodies or malaria-infected erythrocytes binding to the CD36 surface receptor in vitro.. J Clin Invest. 1989; 84(2):468-75. (Biology). 참조 보기
  4. Ockenhouse CF, Tandon NN, Magowan C, Jamieson GA, Chulay JD. Identification of a platelet membrane glycoprotein as a falciparum malaria sequestration receptor.. Science. 1989; 243(4897):1469-71. (Biology). 참조 보기
  5. Tandon NN, Kralisz U, Jamieson GA. Identification of glycoprotein IV (CD36) as a primary receptor for platelet-collagen adhesion.. J Biol Chem. 1989; 264(13):7576-83. (Biology). 참조 보기
  6. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
  7. de Haas M, von dem Borne AEG. CD36 Workshop Panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:636-637.
모두 보기 (7) 간단히 보기
940224 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.