Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD33

BD™ AbSeq Oligo Mouse Anti-Human CD33

Clone HIM3-4 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Siglec-3; SIGLEC3; gp67; p67
945
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGTTTGTGGTGCGGTTTGTTAGGTATCGTTGTGTTT
AHS0246
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940316 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
HIM3-4

The HIM3-4 monoclonal antibody specifically binds to CD33 which is also known as Sialic acid-binding Ig-like lectin 3 (Siglec-3), gp67, or p67. CD33 is a 67 kDa type I transmembrane glycoprotein expressed on monocytes, activated T cells, myeloid progenitors as well as mast cells. CD33 is absent on normal platelets, lymphocytes, erythrocytes and hematopoietic stem cells. This glycoprotein can reportedly function as a sialic acid-dependent cell adhesion molecule. This function can be modulated by endogenous sialoglycoconjugates when CD33 is expressed on the membrane. HIM3-4 reacts with human and monkey granulocytes and monocytes.

940316 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940316 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940316" on CiteAb

개발 참고 자료 (7)

  1. Favaloro EJ, Bradstock KF, Kabral A, Grimsley P, Zowtyj H, Zola H. Further characterization of human myeloid antigens (gp160,95; gp150; gp67): investigation of epitopic heterogeneity and non-haemopoietic distribution using panels of monoclonal antibodies belonging to CD-11b, CD-13 and CD-33. Br J Haematol. 1988; 69(2):163-171. (Biology). 참조 보기
  2. Favaloro EJ, Moraitis N, Koutts J, Exner T, Bradstock KF. Endothelial cells and normal circulating haemopoietic cells share a number of surface antigens. Thromb Haemost. 1989; 61(2):217-224. (Biology). 참조 보기
  3. Freeman SD, Kelm S, Barber EK, Crocker PR. Characterization of CD33 as a new member of the sialoadhesin family of cellular interaction molecules. Blood. 1995; 85(8):2005-2012. (Biology). 참조 보기
  4. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  5. Nakamura Y, Noma M, Kidokoro M, et al. Expression of CD33 antigen on normal human activated T lymphocytes.. Blood. 1994; 83(5):1442-3. (Biology). 참조 보기
  6. Peiper SC, Andrews RG. CD33 cluster workshop report. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:837-840.
  7. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
모두 보기 (7) 간단히 보기
940316 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.