Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD31

BD™ AbSeq Oligo Mouse Anti-Human CD31

Clone WM59 (also known as WM-59)

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
EndoCAM; GPIIA'; PECA1; PECAM1; Platelet endothelial cell adhesion molecule
5175
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CTAAGGGACGTAATTGAGTTTCGGTGATCGCAGTTT
AHS0170
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD31 Olgo AHS0170 WM59 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940254 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
WM59

The WM59 monoclonal antibody specifically binds to platelet endothelial cell adhesion molecule-1, (PECAM-1, PECAM1), which is also known as GPIIA', or EndoCAM. CD31 is a 130 kDa type I transmembrane glycoprotein that belongs to the Ig gene superfamily.  CD31 has wide tissue distribution and is expressed on platelets, monocytes, granulocytes, NK cells, T cell subsets, and in high amounts on endothelial cells. CD31 functions as a vascular endothelial cell adhesion molecule and is involved in the transendothelial migration of leucocytes in inflammatory responses. It might be involved in thrombosis, angiogenesis, and wound healing. The WM59 appears to recognize an epitope proximal to extracellular domain 2 of CD31.

Clone WM59 also cross-reacts with peripheral blood platelets and leukocytes of baboon, and both rhesus and cynomolgus macaque monkeys. The staining intensity of WM59+ platelets is similiar to that observed with peripheral blood platelets from normal human donors. Lymphocytes, monocytes, and granulocytes react less with WM59 than normal human leukocytes.

940254 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940254 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (6)

  1. DeLisser HM, Newman PJ, Albelda SM. Platelet endothelial cell adhesion molecule (CD31). Curr Top Microbiol Immunol. 1993; 184:37-45. (Biology). 참조 보기
  2. Fawcett J, Buckley C, Holness CL, et al. Mapping the homotypic binding sites in CD31 and the role of CD31 adhesion in the formation of interendothelial cell contacts. J Cell Biol. 1995; 128(6):1229-1241. (Clone-specific: Blocking, ELISA). 참조 보기
  3. Lin G-X, Yang X, Hollemweguer E, et al. Cross-reactivity of CD antibodies in eight animal species. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:519-523.
  4. Muller WA, Weigl SA, Deng X, Phillips DM. PECAM-1 is required for transendothelial migration of leukocytes. J Exp Med. 1993; 178(2):449-460. (Biology). 참조 보기
  5. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  6. Vaporciyan AA, DeLisser HM, Yan HC, et al. Involvement of platelet-endothelial cell adhesion molecule-1 in neutrophil recruitment in vivo.. Science. 1993; 262(5139):1580-2. (Biology). 참조 보기
모두 보기 (6) 간단히 보기
940254 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.