Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD1d

BD™ AbSeq Oligo Mouse Anti-Human CD1d

Clone CD1d42 (also known as 42.1) (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
R3; R3G1; HMC class I antigen-like glycoprotein CD1D
912
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTTAGGATTATTGACGTACCGAGTTAGGAGTGATTG
AHS0219
Human CD1d Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940296 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
CD1d42

The CD1d42 monoclonal antibody recognizes CD1d. Cell surface CD1d is structurally homologous to Class I MHC molecules. It consists of a glycosylated type I transmembrane α chain (43-49 kDa) that is non-covalently associated with β2-microglobulin. CD1d is a member of the CD1 family of molecules, which belong to the immunoglobulin superfamily. Sequence homology data classifies the CD1 molecules into two groups. Group 1 includes CD1a, CD1b and CD1c molecules; group 2 includes CD1d molecules and their homologs in other species. CD1d is expressed on cortical thymocytes, B cells, dendritic cells, monocytes, and some nonlymphoid cells including intestinal epithelial cells, hepatocytes and keratinocytes. It is not expressed on resting mature T cells. Studies suggest that CD1d participates in lipid antigen presentation to CD1d-restricted NKT cells.

940296 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940296 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940296" on CiteAb

개발 참고 자료 (5)

  1. Exley M, Garcia J, Wilson SB, et al. CD1d structure and regulation on human thymocytes, peripheral blood T cells, B cells and monocytes. Immunology. 2000; 100(1):37-47. (Immunogen: Flow cytometry, Immunohistochemistry, Immunoprecipitation). 참조 보기
  2. Hong S, Scherer DC, Singh N. Lipid antigen presentation in the immune system: lessons learned from CD1d knockout mice. Immunol Rev. 1999; 169:31-44. (Biology). 참조 보기
  3. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  4. Ronger-Savle S, Valladeau J, Claudy A, et al. TGFbeta inhibits CD1d expression on dendritic cells. J Invest Dermatol. 2005; 124(1):116-118. (Clone-specific: Flow cytometry). 참조 보기
  5. Somnay-Wadgaonkar K, Nusrat A, Kim HS. Immunolocalization of CD1d in human intestinal epithelial cells and identification of a beta2-microglobulin-associated form. 1999; 11(3):383-392. (Biology). 참조 보기
940296 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.