Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD161

BD™ AbSeq Oligo Mouse Anti-Human CD161

Clone HP-3G10

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
CLEC5B; KLRB1; NKR-P1A; NKRP1A
3820
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTTAGGACGATTAGTTGTGCGGCATAGGAGGTGTTC
AHS0205
Human NK cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD161 Olgo AHS0205 HP-3G10 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940283 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
HP-3G10

The HP-3G10 monoclonal antibody specifically recognizes human CD161 which is also known as Natural killer cell surface protein P1A (NKR-P1A or NKRP1A) or C-type lectin domain family 5 member B (CLEC5B). CD161 is expressed on the cell surface as an 80 kDa disulfide-linked homodimeric type II transmembrane glycoprotein. It is encoded by KLRB1 (Killer cell lectin-like receptor subfamily B member 1) which belongs to the Ca2+-dependent C-type lectin superfamily. CD161 is expressed on NK cells and on subsets of CD4+ and CD8+ αβ T cells, NKT cells, γδ T cells, CD3+ thymocytes, and fetal liver cells. CD161 is preferentially expressed on memory/effector T cells. CD161 can reportedly inhibit NK cell-mediated cytotoxicity and IFN-γ production. Lectin-like transcript 1 (LLT-1), encoded by CLEC2D (C-type lectin domain family 2 member D), has been described as a ligand for CD161. LLT-1 is expressed on some activated dendritic cells (DC) and B cells.

940283 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940283 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (5)

  1. Ida H, Morita C, Porcelli S, Anderson P. CD161 workshop: Reactivity of workshop natural killer cell monoclonal antibodies on fresh and interleukin 2-activated peripheral blood natural killer cells and CD4-negative CD8-negative αβ and γδ T-cell clones. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:313-317.
  2. Lanier LL, Chang C, Phillips JH. Human NKR-P1A. A disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of NK and T lymphocytes. J Immunol. 1994; 153(6):2417-2428. (Biology). 참조 보기
  3. Márquez C, Trigueros C, Franco JM, et al. Identification of a common developmental pathway for thymic natural killer cells and dendritic cells.. Blood. 1998; 91(8):2760-71. (Clone-specific: Flow cytometry). 참조 보기
  4. Poggi A, Revello V, Nanni L, Costa P, Moretta A. CD161 (human NKR-P1A) workshop panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:307-312.
  5. Rosen DB, Cao W, Avery DT, et al. Functional consequences of interactions between human NKR-P1A and its ligand LLT1 expressed on activated dendritic cells and B cells.. J Immunol. 2008; 180(10):6508-17. (Biology). 참조 보기
940283 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.