Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD158e1 (NKB1)

BD™ AbSeq Oligo Mouse Anti-Human CD158e1 (NKB1)

Clone DX9

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
KIR3DL1; CD158E; CD158E1; KIR antigen 3DL1; KIR; KI3L1; NKAT-3; NKB1; NKB1B
3811
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGGTTCATTGCGGCATTAGGCGTCATATAGTAGGTG
AHS0211
Human NK Cell Clone
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD158E1 (NKB1) Olgo AHS0211 DX9 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940289 Rev. 3
항체 세부 정보
Down Arrow Up Arrow
DX9

The DX9 monoclonal antibody specifically binds to CD158e1, also known as NKB1. CD158e1 functions as a killer cell inhibitory receptor (KIR) and is encoded by KIR3DL1 (Killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail).  CD158e1 is a 70 kDa glycoprotein that belongs to the Ig superfamily. It is expressed on a subset of natural killer cells and a small subset of T cells. Expression of CD158e1 has been observed to vary among individuals. KIR molecules specifically recognize a certain group of HLA class I antigens. Interaction of CD158e1 with specific HLA-B antigen on a target cell appears to inhibit cell-mediated cytotoxicity by delivering a negative signal that prevents lymphocyte activation. It is suggested that this MHC class I-KIR interaction works as a signaling mechanism that regulates NK and T-cell responses to antigenic challenge.

940289 Rev. 3
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940289 Rev.3
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (10)

  1. D'Andrea A, Chang C, Franz-Bacon K, McClanahan T, Phillips JH, Lanier LL. Molecular cloning of NKB1. A natural killer cell receptor for HLA-B allotypes. J Immunol. 1995; 155(5):2306-2310. (Biology). 참조 보기
  2. D'Andrea A, Chang C, Phillips JH, Lanier LL. Regulation of T cell lymphokine production by killer cell inhibitory receptor recognition of self HLA class I alleles. J Exp Med. 1996; 184(2):789-794. (Biology). 참조 보기
  3. Fry AM, Lanier LL, Weiss A. Phosphotyrosines in the killer cell inhibitory receptor motif of NKB1 are required for negative signaling and for association with protein tyrosine phosphatase 1C. J Exp Med. 1996; 184(1):295-300. (Biology). 참조 보기
  4. Gumperz JE, Paterson JC, Litwin V, et al. Specificity of two anti-class I HLA monoclonal antibodies that block class I recognition by the NKB1 killer cell inhibitory receptor. Tissue Antigens. 1996; 48(4):278-284. (Clone-specific: Blocking, Inhibition). 참조 보기
  5. Gumperz JE, Valiante NM, Parham P, Lanier LL, Tyan D. Heterogeneous phenotypes of expression of the NKB1 natural killer cell class I receptor among individuals of different human histocompatibility leukocyte antigens types appear genetically regulated, but not linked to major histocompatibililty complex. J Exp Med. 1996; 183(4):1817-1827. (Clone-specific: Blocking, Flow cytometry, Fluorescence activated cell sorting, Functional assay, Immunoprecipitation, Inhibition). 참조 보기
  6. Lanier LL, Peterson M, Long EO. Antibody reactivity with NK receptors expressed on transfected cells. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:413-414.
  7. Litwin V, Gumperz J, Parham P, Phillips JH, Lanier LL. NKB1: a natural killer cell receptor involved in the recognition of polymorphic HLA-B molecules. J Exp Med. 1994; 180(2):537-543. (Immunogen: Bioassay, Blocking, Flow cytometry, Immunoprecipitation, Radioimmunoassay). 참조 보기
  8. Pascal V, Vivier E, Andre P. CD158 (killer immunoglobulin-like receptors family) report. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:412-413.
  9. Sivori S, Vitale M, Bottino C, et al. CD94 functions as a natural killer cell inhibitory receptor for different HLA class I alleles: identification of the inhibitory form of CD94 by the use of novel monoclonal antibodies. Eur J Immunol. 1996; 26(10):2487-2492. (Biology). 참조 보기
  10. Wagtmann N, Rajagopalan S, Winter CC, Peruzzi M, Long EO. Killer cell inhibitory receptors specific for HLA-C and HLA-B identified by direct binding and by functional transfer. Immunity. 1995; 3(6):801-809. (Biology). 참조 보기
모두 보기 (10) 간단히 보기
940289 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.