Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD146

BD™ AbSeq Oligo Mouse Anti-Human CD146

Clone P1H12 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
MCAM; MELCAM; MUC18; Gicerin; Melanoma cell adhesion molecule
4162
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGGTTATTTAGGTGACGGTTGTATTGACGAGAGAGG
AHS0127
Human Umbilical Vein Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940218 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
P1H12

The P1H12 monoclonal antibody specifically binds to CD146. CD146 is a 118 kDa transmembrane glycoprotein also known as MCAM, MUC18, or Mel-CAM. CD146 is a member of the immunoglobulin superfamily strongly expressed by blood vessel endothelium and smooth muscle. CD146 is also expressed by angioblasts, mesenchymal stem cells, melanoma cells, intermediate trophoblasts and a subpopulation of activated T cells. The P1H12 monoclonal antibody has been reported to block endothelial cell adhesion that is observed very early in embryogenesis. It can be useful in the study of embryologic vasculogenesis. This antibody is suitable for immunohistochemical staining of acetone-fixed frozen tissue sections, immunoprecipitation and ELISA.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

NOTE:  The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.

940218 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940218 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940218" on CiteAb

개발 참고 자료 (7)

  1. Elshal MF, Khan SS, Takahashi Y, Solomon MA, McCoy JP, Jr. CD146 (Mel-CAM), an adhesion marker of endothelial cells, is a novel marker of lymphocyte subset activation in normal peripheral blood. Blood. 2005; 106(8):2923-2924. (Clone-specific: Flow cytometry). 참조 보기
  2. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  3. Sers C, Kirsch K, Rothbächer U, Riethmüller G, Johnson JP. Genomic organization of the melanoma-associated glycoprotein MUC18: implications for the evolution of the immunoglobulin domains. Proc Natl Acad Sci U S A. 1993; 90(18):8514-8518. (Biology). 참조 보기
  4. Shih IM, Elder DE, Hsu MY, Herlyn M. Regulation of Mel-CAM/MUC18 expression on melanocytes of different stages of tumor progression by normal keratinocytes. Am J Pathol. 1994; 145(4):837-845. (Biology). 참조 보기
  5. Shih IM. The role of CD146 (Mel-CAM) in biology and pathology. J Pathol. 1999; 189(1):4-11. (Biology). 참조 보기
  6. Solovey A, Lin Y, Browne P, Choong S, Wayner E, Hebbel R P. Circulating activated endothelial cells in sickle cell anemia. N Engl J Med. 1997; 337(22):1584-1590. (Immunogen: Cell separation, Flow cytometry, Fluorescence microscopy, Immunofluorescence). 참조 보기
  7. Solovey AN, Gui L, Chang L, Enenstein J, Browne PV, Hebbel RP. Identification and functional assessment of endothelial P1H12. J Lab Clin Med. 2001; 138(5):322-331. (Clone-specific: Activation, Functional assay, Inhibition, Stimulation). 참조 보기
모두 보기 (7) 간단히 보기
940218 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.