Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD140a

BD™ AbSeq Oligo Mouse Anti-Human CD140a

Clone αR1 (also known as Alpha-R1)

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
PDGF Receptor α; PDGFRA; PDGFRα; PDGF-R-alpha; PDGFR2; PGFRA; RHEPDGFRA
5156
2 µl
Mouse BALB/c IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTACTGACTTTCGGACGTTGGTTACTTAGGGTTATG
AHS0160
Human PDGFRα Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD140A Olgo AHS0160 Alpha-R1 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940246 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
αR1

The αR1 monoclonal antibody specifically binds to the human platelet derived growth factor (PDGF) receptor α (PDGFRα), also known as CD140a. CD140a is a 170 kDa single transmembrane glycoprotein expressed on fibroblasts, smooth muscle cells, glial cells and chondrocytes. PDGF receptors α and β are single glycoproteins with intracellular tyrosine kinase domains. They are structurally similar to the M-CSF receptor and CD117 (c-kit). Their ligand, PDGF, is a mitogen for connective tissue cells and glial cells. PDGF plays a role in wound healing and it also acts as a chemoattractant for fibroblasts, smooth muscle cells, glial cells, monocytes and neutrophils. Functional PDGF is secreted in disulfide linked, homodimeric or heterodimeric forms comprised of A or B chains (PDGFAA, PDGF-BB or PDGF-AB). Binding of divalent PDGF induces receptor dimerization with three possible forms: αα, αβ, ββ. The PDGFRα subunit binds both PDGF A and B chains, whereas the PDGFRβ subunit binds only PDGF B chains. Although both receptor subunits can stimulate mitogenic responses, only the β subunit can induce chemotaxis. The αR1 antibody is specific for PDGFRα and does not crossreact with PDGFRβ. It immunoprecipitates human, monkey, rabbit, pig, dog and cat PDGFRα. It does not recognize hamster, rat or mouse PDGFRα.

940246 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940246 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (5)

  1. Bazenet CE, Kazlauskas A. The PDGF receptor alpha subunit activates p21ras and triggers DNA synthesis without interacting with rasGAP. Oncogene. 1993; 9(2):517-525. (Biology). 참조 보기
  2. Callard R, Gearing A. Callard R, Gearing A. The Cytokine Facts Book. San Diego: Academic Press; 1994.
  3. Hart CE, Bowen-Pope DF. CD140a and b (PDGRα and β) Workshop Panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:739-741.
  4. Kitayama J, Springer TA. Endothelial Cell Blind Panel analysis: Overview and summary. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:717-721.
  5. LaRochelle WJ, Jensen RA, Heidaran MA, et al. Inhibition of platelet-derived growth factor autocrine growth stimulation by a monoclonal antibody to the human alpha platelet-derived growth factor receptor. Cell Growth Differ. 1993; 4(7):547-553. (Immunogen: Flow cytometry, Functional assay, Immunoprecipitation). 참조 보기
940246 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.