Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD110

BD™ AbSeq Oligo Mouse Anti-Human CD110

Clone 1.6.1

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
C-MPL; MPL; MPLV; TPOR; Thrombopoietin receptor
2 µl
Mouse IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAATTGGAGGTGTAAACGCGTAGTAGATCGATAAGC
AHS0225
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD110 Olgo AHS0225 1.6.1 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940302 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
1.6.1

The 1.6.1 monoclonal antibody specifically binds to the human Thrombopoietin Receptor (TPO-R) that is also known as the Myeloproliferative leukemia protein (c-Mpl) or CD110. CD110 is a type I transmembrane glycoprotein and a member of the hematopoietin receptor family. It is expressed on hematopoietic stem cells, a subfraction of hematopoietic precursor cells, cells of the megakaryocytic lineage and platelets. CD110 serves as a receptor for thrombopoietin. Upon binding of thrombopoietin to CD110, megakaryocyte proliferation and differentiation is induced, platelets are produced and stem cells are protected from apoptosis.

940302 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940302 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (6)

  1. Abbott C, Huang G, Ellison AR, et al. Mouse monoclonal antibodies against human c-Mpl and characterization for flow cytometry applications.. Hybridoma (Larchmt). 2010; 29(2):103-13. (Clone-specific: Flow cytometry). 참조 보기
  2. Broudy VC, Lin NL, Fox N, Taga T, Saito M, Kaushansky K. Thrombopoietin stimulates colony-forming unit-megakaryocyte proliferation and megakaryocyte maturation independently of cytokines that signal through the gp130 receptor subunit. Blood. 1996; 88(6):2026-2032. (Biology). 참조 보기
  3. Deng B, Banu N, Malloy B, et al. An agonist murine monoclonal antibody to the human c-Mpl receptor stimulates megakaryocytopoiesis. Blood. 1998; 92(6):1981-1988. (Biology). 참조 보기
  4. Fox NE, Lim J, Chen R, Geddis AE. F104S c-Mpl responds to a transmembrane domain-binding thrombopoietin receptor agonist: proof of concept that selected receptor mutations in congenital amegakaryocytic thrombocytopenia can be stimulated with alternative thrombopoietic agents. Exp Hematol. 2010; 38(5):384-391. (Clone-specific: Flow cytometry). 참조 보기
  5. Gotoh A, Ritchie A, Takahira H, Broxmeyer HE. Thrombopoietin and erythropoietin activate inside-out signaling of integrin and enhance adhesion to immobilized fibronectin in human growth-factor-dependent hematopoietic cells. Ann Hematol. 1997; 75(5-6):207-213. (Biology). 참조 보기
  6. Sigurjonsson OE, Gudmundsson KO, Haraldsdottir V, Rafnar T, Agnarsson BA, Gudmundsson S. Flt3/Flk-2 ligand in combination with thrombopoietin decreases apoptosis in megakaryocyte development. Stem Cells Dev. 2004; 13(2):183-191. (Biology). 참조 보기
모두 보기 (6) 간단히 보기
940302 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.