Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD79b

BD™ AbSeq Oligo Hamster Anti-Mouse CD79b

Clone HM79b (also known as HM79-16) (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Igβ; Igb; Ig-beta; Immunoglobulin-associated beta
15985
2 µl
Armenian Hamster IgG, λ1
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GAGGTTCGAGGTAGGTATAATAAGATGGTTGAGAGC
AMM2227
Mouse B lymphoma, WEHI-123
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
  8. Please refer to bd.com/genomics-resources for technical protocols.
  9. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940448 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
HM79b

The HM79b monoclonal antibody specifically recognizes an extracellular epitope of Ig β chain (Igβ or CD79b), a 35-40-kDa transmembrane protein which forms an 80-90-kDa disulfide-linked heterodimer with Ig α chain (Igα or CD79a, 30-35 kDa).  On mature B lymphocytes, the CD79a/CD79b heterodimers are non-covalently associated with surface IgM to form the B-cell receptor complex (BCR). The presence of CD79a/CD79b is necessary for surface expression of the BCR and signal transduction via the BCR in B lymphocytes and pre-B cells. It was recently reported that CD79b may be expressed on the cell surface preceding the appearance of surface IgM during B-lymphocyte development. At this pro-B-cell stage, CD79b participates in signal transduction involved in the regulation of B-cell development. It should be noted that multi-parameter flow cytometric analyses of bone marrow suspensions performed at BD Biosciences Pharmingen have been unable to detect surface staining by HM79b mAb on CD45R/B220+ IgM- cells.

940448 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940448 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940448" on CiteAb

개발 참고 자료 (7)

  1. Gong S, Nussenzweig MC. Regulation of an early developmental checkpoint in the B cell pathway by Ig beta. Science. 1996; 272(5260):411-414. (Biology). 참조 보기
  2. Koyama M, Ishihara K, Karasuyama H, Cordell JL, Iwamoto A, Nakamura T. CD79 alpha/CD79 beta heterodimers are expressed on pro-B cell surfaces without associated mu heavy chain. Int Immunol. 1997; 9(11):1767-1772. (Immunogen). 참조 보기
  3. Nagata K, Nakamura T, Kitamura F, et al. The Ig alpha/Igbeta heterodimer on mu-negative proB cells is competent for transducing signals to induce early B cell differentiation. Immunity. 1997; 7(4):559-570. (Biology). 참조 보기
  4. Papavasiliou F, Jankovic M, Suh H, Nussenzweig MC. The cytoplasmic domains of immunoglobulin (Ig) alpha and Ig beta can independently induce the precursor B cell transition and allelic exclusion. J Exp Med. 1995; 182(5):1389-1394. (Biology). 참조 보기
  5. Papavasiliou F, Misulovin Z, Suh H, Nussenzweig MC. The role of Ig beta in precursor B cell transition and allelic exclusion. Science. 1995; 268(5209):408-411. (Biology). 참조 보기
  6. Pleiman CM, D'Ambrosio D, Cambier JC. The B-cell antigen receptor complex: structure and signal transduction. Immunol Today. 1994; 15(9):393-399. (Biology). 참조 보기
  7. Reth M. Antigen receptors on B lymphocytes. Annu Rev Immunol. 1992; 10:97-121. (Biology). 참조 보기
모두 보기 (7) 간단히 보기
940448 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.