Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD69

BD™ AbSeq Oligo Hamster Anti-Mouse CD69

Clone H1.2F3 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
VEA; Very Early Activation Antigen; AIM; Activation Induced Molecule
12515
2 µl
Armenian Hamster IgG1, λ3
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTAGAATGATTAGCGGTATATGTCGTGATGCAGCGT
AMM2022
Mouse Dendritic Epidermal T Cell Line Y245
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940126 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
H1.2F3

The H1.2F3 monoclonal antibody specifically binds to CD69 (Very Early Activation antigen), an 85 kDa disulfide-linked homodimer of differentially glycosylated subunits. CD69 is a C-type lectin, most closely related to the NKR-P1 and Ly-49 NK cell-activation molecules. Its expression is rapidly induced upon activation of lymphocytes (T, B, NK, and NK-T cells), neutrophils, and macrophages. CD69 is expressed also on thymocytes that are undergoing positive selection; its role in that process is unclear. H1.2F3 mAb augments PMA-induced T-cell stimulation and IFN-γ-induced macrophage stimulation. IL-2-activated NK cells express CD69, and H1.2F3 mAb induces redirected lysis of FcR-bearing target cells by NK cells.

940126 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940126 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940126" on CiteAb

개발 참고 자료 (15)

  1. Bendelac A, Matzinger P, Seder RA, Paul WE, Schwartz RH. Activation events during thymic selection. J Exp Med. 1992; 175(3):731-742. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). 참조 보기
  2. Gabor MJ, Godfrey DI, Scollay R. Recent thymic emigrants are distinct from most medullary thymocytes. Eur J Immunol. 1997; 27(8):2010-2050. (Clone-specific: Flow cytometry). 참조 보기
  3. Karlhofer FM, Yokoyama WM. Stimulation of murine natural killer (NK) cells by a monoclonal antibody specific for the NK1.1 antigen. IL-2-activated NK cells possess additional specific stimulation pathways. J Immunol. 1991; 146(10):3662-3673. (Clone-specific: Induction). 참조 보기
  4. Keefe R, Dave V, Allman D, Wiest D, Kappes DJ. Regulation of lineage commitment distinct from positive selection. Science. 1999; 286(5442):1149-1153. (Biology). 참조 보기
  5. Lauzurica P, Sancho D, Torres M, et al. Phenotypic and functional characteristics of hematopoietic cell lineages in CD69-deficient mice. Blood. 2000; 95(7):2312-2320. (Clone-specific: Flow cytometry). 참조 보기
  6. Marzio R, Jirillo E, Ransijn A, Mauel J, Corradin SB. Expression and function of the early activation antigen CD69 in murine macrophages. J Leukoc Biol. 1997; 62(3):349-355. (Clone-specific: Activation). 참조 보기
  7. Merkenschlager M, Graf D, Lovatt M, Bommhardt U, Zamoyska R, Fisher AG. How many thymocytes audition for selection. J Exp Med. 1997; 186(7):1149-1158. (Clone-specific: Flow cytometry). 참조 보기
  8. Nishimura T, Kitamura H, Iwakabe K, et al. The interface between innate and acquired immunity: glycolipid antigen presentation by CD1d-expressing dendritic cells to NKT cells induces the differentiation of antigen-specific cytotoxic T lymphocytes. Int Immunol. 2000; 12(7):987-994. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). 참조 보기
  9. Punt JA, Suzuki H, Granger LG, Sharrow SO, Singer A. Lineage commitment in the thymus: only the most differentiated (TCRhibcl-2hi) subset of CD4+CD8+ thymocytes has selectively terminated CD4 or CD8 synthesis. J Exp Med. 1996; 184(6):2091-2099. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). 참조 보기
  10. Sobel ES, Yokoyama WM, Shevach EM, Eisenberg RA, Cohen PL. Aberrant expression of the very early activation antigen on MRL/Mp-lpr/lpr lymphocytes. J Immunol. 1993; 150(2):673-682. (Clone-specific: Stimulation). 참조 보기
  11. Wilkinson RW, Anderson G, Owen JJ, Jenkinson EJ. Positive selection of thymocytes involves sustained interactions with the thymic microenvironment. J Immunol. 1995; 155(11):5234-5240. (Clone-specific: Cell separation, Flow cytometry). 참조 보기
  12. Yokoyama WM, Koning F, Kehn PJ, et al. Characterization of a cell surface-expressed disulfide-linked dimer involved in murine T cell activation. J Immunol. 1988; 141(2):369-376. (Immunogen: Flow cytometry, Immunoprecipitation, Stimulation). 참조 보기
  13. Yokoyama WM, Maxfield SR, Shevach EM. Very early (VEA) and very late (VLA) activation antigens have distinct functions in T lymphocyte activation. Immunol Rev. 1989; 109:153-176. (Clone-specific: Flow cytometry, Stimulation). 참조 보기
  14. Ziegler SF, Levin SD, Johnson L, et al. The mouse CD69 gene. Structure, expression, and mapping to the NK gene complex. J Immunol. 1994; 152(3):1228-1236. (Clone-specific: Flow cytometry). 참조 보기
  15. Ziegler SF, Ramsdell F, Alderson MR. The activation antigen CD69. Stem Cells. 1994; 12(5):456-465. (Biology: Flow cytometry). 참조 보기
모두 보기 (15) 간단히 보기
940126 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.