Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD27

BD™ AbSeq Oligo Hamster Anti-Mouse CD27

Clone LG.3A10 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Tnfrsf7; Tumor necrosis factor receptor superfamily member 7; Tp55; S152
21940
2 µl
Armenian Hamster IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGTCGCTAATCGTGGTAAATCATATAAGGGTTCGGG
AMM2053
Armenian hamster fibroblast line ARHO12 transfected with mouse Cd27 cDNA
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940157 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
LG.3A10

The LG.3A10 monoclonal antibody specifically binds to CD27, a lymphocyte-restricted member of the Tumor Necrosis Factor Receptor family which binds to CD70. The CD27 molecule is a 45-kDa transmembrane glycoprotein which is constitutively expressed by lymphocytes of the T lineage: virtually all thymocytes and over 90% of peripheral T cells bearing both αβ and γδ T-cell receptors. CD27 cooperates with the pre-TCR in mediating thymocyte differentiation and expansion. In addition, one to ten percent of mature peripheral B cells express CD27, and CD27's role in the differentiation of human plasma cells has been studied. Mouse NK cells, freshly isolated and IL-2-activated, also express CD27. In the bone marrow, CD27 is found on a progenitor population which provides short-term hematopoietic reconstitution. Cells of the myeloid lineage do not express CD27. Cross-linked LG.3A10 mAb has been reported to amplify the proliferative response of purified T lymphocytes to suboptimal mitogenic stimulation1 and to enhance NK-cell proliferation and IFN-γ production. In contrast, non-cross-linked LG.3A10 mAb inhibits CD3-induced pre-T cell development by interfering with the receptor-ligand interaction. This hamster mAb to a mouse leukocyte antigen has been observed to cross-react with a similar population of rat leukocytes.

940157 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940157 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940157" on CiteAb

개발 참고 자료 (6)

  1. Agematsu K, Hokibara S, Nagumo H, Shinozaki K, Yamada S, Komiyama A. Plasma cell generation from B-lymphocytes via CD27/CD70 interaction. Leuk Lymphoma. 1999; 35(3-4):219-225. (Biology). 참조 보기
  2. Gravestein LA, Blom B, Nolten LA, et al. Cloning and expression of murine CD27: comparison with 4-1BB, another lymphocyte-specific member of the nerve growth factor receptor family. Eur J Immunol. 1993; 23(4):943-950. (Biology). 참조 보기
  3. Gravestein LA, Nieland JD, Kruisbeek AM, Borst J. Novel mAbs reveal potent co-stimulatory activity of murine CD27. Int Immunol. 1995; 7(4):551-557. (Immunogen: (Co)-stimulation, Flow cytometry, Functional assay, Immunofluorescence, Immunoprecipitation). 참조 보기
  4. Gravestein LA, van Ewijk W, Ossendorp F, Borst J. CD27 cooperates with the pre-T cell receptor in the regulation of murine T cell development. J Exp Med. 1996; 184(2):675-685. (Clone-specific: Flow cytometry, Immunofluorescence, Inhibition). 참조 보기
  5. Takeda K, Oshima H, Hayakawa Y, et al. CD27-mediated activation of murine NK cells. J Immunol. 2000; 164(4):1741-1745. (Clone-specific: (Co)-stimulation, Enhancement, Flow cytometry). 참조 보기
  6. Wiesmann A, Phillips RL, Mojica M, et al. Expression of CD27 on murine hematopoietic stem and progenitor cells. Immunity. 2000; 12(2):193-199. (Clone-specific: Flow cytometry). 참조 보기
모두 보기 (6) 간단히 보기
940157 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.