Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD154

BD™ AbSeq Oligo Hamster Anti-Mouse CD154

Clone MR1

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
CD40 Ligand; CD40L; gp39; Ly-62; Tnfsf5; T-BAM; HIGM1; IMD3
21947
2 µl
Armenian Hamster IgG3, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TAGGTATGAAGACGAGGTTTATGATGCGAAGGGACT
AMM2195
Activated mouse Th1 clone D1.6
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster
Ms CD154 Olgo AMM2195 MR1 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
  8. Please refer to bd.com/genomics-resources for technical protocols.
  9. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 mL 카탈로그 No. 554656
sampleImage/
BD Rhapsody™ Scanner RUO
사이즈 1 Each 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 Each 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940435 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
MR1

The MR1 monoclonal antibody specifically binds to CD154 (CD40 Ligand, gp39), an accessory molecule expressed on activated T helper (CD4+) lymphocytes. CD154 has also been detected on other types of leukocytes, including CD8+ T cells, medullary thymocytes, activated CD4+ NK-T cells, and human NK cells. CD154 plays an important role in costimulatory interactions between T and B lymphocytes and between antigen-presenting cells and lymphocytes, regulating the immune response at multiple levels. MR1 mAb inhibits in vitro activation of B lymphocytes by T helper cells by blocking interaction of gp39 with CD40. In vitro interactions of T cells and antigen-presenting cells can also be blocked by the MR1 antibody. In vivo treatment with MR1 antibody blocks the development of experimental autoimmune disease, inhibits formation of germinal centers and generation of memory B cells, reduces T-lymphocyte responses to allogeneic cells and allografts, prevents intrathymic deletion of self-reactive T lymphocytes, and disrupts antigen-specific T-cell responses.

940435 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940435 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (23)

  1. Carbone E, Ruggiero G, Terrazzano G, et al. A new mechanism of NK cell cytotoxicity activation: the CD40-CD40 ligand interaction. J Exp Med. 1997; 185(12):2053-2060. (Biology). 참조 보기
  2. DeKruyff RH, Gieni RS, Umetsu DT. Antigen-driven but not lipopolysaccharide-driven IL-12 production in macrophages requires triggering of CD40. J Immunol. 1997; 158(1):359-366. (Biology). 참조 보기
  3. Dunn RJ, Luedecker CJ, Haugen HS, Clegg CH, Farr AG. Thymic overexpression of CD40 ligand disrupts normal thymic epithelial organization. J Histochem Cytochem. 1997; 45(1):129-141. (Biology). 참조 보기
  4. Durie FH, Fava RA, Foy TM, Aruffo A, Ledbetter JA, Noelle RJ. Prevention of collagen-induced arthritis with an antibody to gp39, the ligand for CD40. Science. 1993; 261(5126):1328-1330. (Biology). 참조 보기
  5. Foy TM, Laman JD, Ledbetter JA, Aruffo A, Claassen E, Noelle RJ. gp39-CD40 interactions are essential for germinal center formation and the development of B cell memory. J Exp Med. 1994; 180(1):157-163. (Biology). 참조 보기
  6. Foy TM, Page DM, Waldschmidt TJ, et al. An essential role for gp39, the ligand for CD40, in thymic selection. J Exp Med. 1995; 182(5):1377-1388. (Biology). 참조 보기
  7. Garside P, Ingulli E, Merica RR, Johnson JG, Noelle RJ, Jenkins MK. Visualization of specific B and T lymphocyte interactions in the lymph node. Science. 1998; 281(5373):96-99. (Biology). 참조 보기
  8. Graca L, Honey K, Adams E, Cobbold SP, Waldmann H. Cutting edge: anti-CD154 therapeutic antibodies induce infectious transplantation tolerance. J Immunol. 2000; 165(9):4783-4786. (Biology). 참조 보기
  9. Grewal IS, Flavell RA. CD40 and CD154 in cell-mediated immunity. Annu Rev Immunol. 1998; 16:111-135. (Biology). 참조 보기
  10. Griggs ND, Agersborg SS, Noelle RJ, Ledbetter JA, Linsley PS, Tung KS. The relative contribution of the CD28 and gp39 costimulatory pathways in the clonal expansion and pathogenic acquisition of self-reactive T cells. J Exp Med. 1996; 183(3):801-810. (Biology). 참조 보기
  11. Kalled SL, Cutler AH, Datta SK, Thomas DW. Anti-CD40 ligand antibody treatment of SNF1 mice with established nephritis: preservation of kidney function. J Immunol. 1998; 160(5):2158-2165. (Biology). 참조 보기
  12. Kawano T, Cui J, Koezuka Y, et al. CD1d-restricted and TCR-mediated activation of valpha14 NKT cells by glycosylceramides. Science. 1997; 278(5343):1626-1629. (Biology). 참조 보기
  13. Kelsall BL, Stuber E, Neurath M, Strober W. Interleukin-12 production by dendritic cells. The role of CD40-CD40L interactions in Th1 T-cell responses. Ann N Y Acad Sci. 1996; 795:116-126. (Biology). 참조 보기
  14. Laman JD, Claassen E, Noelle RJ. Functions of CD40 and its ligand, gp39 (CD40L). Crit Rev Immunol. 1996; 16(1):59-108. (Biology). 참조 보기
  15. Larsen CP, Elwood ET, Alexander DZ, et al. Long-term acceptance of skin and cardiac allografts after blocking CD40 and CD28 pathways. Nature. 1996; 381(6581):434-438. (Biology). 참조 보기
  16. Masten BJ, Yates JL, Pollard Koga AM, Lipscomb MF. Characterization of accessory molecules in murine lung dendritic cell function: roles for CD80, CD86, CD54, and CD40L. Am J Respir Cell Mol Biol. 1997; 16(3):335-342. (Biology). 참조 보기
  17. Miga AJ, Masters SR, Durell BG, et al. Dendritic cell longevity and T cell persistence is controlled by CD154-CD40 interactions. Eur J Immunol. 2001; 31(3):959-965. (Biology). 참조 보기
  18. Nishimura T, Kitamura H, Iwakabe K, et al. The interface between innate and acquired immunity: glycolipid antigen presentation by CD1d-expressing dendritic cells to NKT cells induces the differentiation of antigen-specific cytotoxic T lymphocytes. Int Immunol. 2000; 12(7):987-994. (Biology). 참조 보기
  19. Noelle RJ, Roy M, Shepherd DM, Stamenkovic I, Ledbetter JA, Aruffo A. A 39-kDa protein on activated helper T cells binds CD40 and transduces the signal for cognate activation of B cells. Proc Natl Acad Sci U S A. 1992; 89(14):6550-6554. (Immunogen). 참조 보기
  20. Roy M, Aruffo A, Ledbetter J, Linsley P, Kehry M, Noelle R. Studies on the interdependence of gp39 and B7 expression and function during antigen-specific immune responses. Eur J Immunol. 1995; 25(2):596-603. (Biology). 참조 보기
  21. Roy M, Waldschmidt T, Aruffo A, Ledbetter JA, Noelle RJ. The regulation of the expression of gp39, the CD40 ligand, on normal and cloned CD4+ T cells. J Immunol. 1993; 151(5):2497-2510. (Biology). 참조 보기
  22. Tian L, Noelle RJ, Lawrence DA. Activated T cells enhance nitric oxide production by murine splenic macrophages through gp39 and LFA-1. Eur J Immunol. 1995; 25(1):306-309. (Biology). 참조 보기
  23. Tomura M, Yu WG, Ahn HJ, et al. A novel function of Valpha14+CD4+NKT cells: stimulation of IL-12 production by antigen-presenting cells in the innate immune system. J Immunol. 1999; 163(1):93-101. (Biology). 참조 보기
모두 보기 (23) 간단히 보기
940435 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.