Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD11c

BD™ AbSeq Oligo Hamster Anti-Mouse CD11c

Clone N418

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Itgax; Integrin alpha-X; Integrin αX; ITAX; CR4; Complement Receptor 4
2 µl
Armenian Hamster IgG2
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATGGTAGATGTATAGCGATGGTAAGTTGGTGGATTC
AMM2101
Mouse Dendritic Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster
Ms CD11C Olgo AMM2101 N418 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
  8. Please refer to bd.com/genomics-resources for technical protocols.
  9. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 mL 카탈로그 No. 554656
sampleImage/
BD Rhapsody™ Scanner RUO
사이즈 1 Each 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 Each 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940321 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
N418

The N418 monoclonal antibody specifically binds to CD11c, the Integrin alpha X (Integrin αX, Itgax) chain of the heterodimeric gp150, 95 (CD11c/CD18, αXβ2) integrin that forms the complement receptor 4 (CR4). CD11c is a150 kDa type I transmembrane glycoprotein that is expressed on dendritic cells, CD4-CD8+ intestinal intraepithelial lymphocytes (IEL), and some NK cells and T cells. CD11c expression is upregulated on IEL and T cells following activation. Cells of the monocyte/macrophage lineage have been reported to express low levels of CD11c. The CD11c/CD18 integrin can bind to several ligands including iC3b, fibrinogen, and CD54. This integrin reportedly plays important roles in phagocytosis and in mediating cellular interactions during inflammation.

940321 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940321 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (3)

  1. Crowley MT, Inaba K, Witmer-Pack MD, Gezelter S, Steinman RM. Use of the fluorescence activated cell sorter to enrich dendritic cells from mouse spleen. J Immunol Methods. 1990; 133(1):55-66. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). 참조 보기
  2. Metlay JP, Witmer-Pack MD, Agger R, Crowley MT, Lawless D, Steinman RM. The distinct leukocyte integrins of mouse spleen dendritic cells as identified with new hamster monoclonal antibodies. J Exp Med. 1990; 171(5):1753-1771. (Immunogen: Flow cytometry, Immunohistochemistry, Immunoprecipitation). 참조 보기
  3. Sadhu C, Ting HJ, Lipsky B, et al. CD11c/CD18: novel ligands and a role in delayed-type hypersensitivity. J Leukoc Biol. 2007; 81(6):1395-1403. (Clone-specific: Blocking). 참조 보기
940321 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.