Skip to main content Skip to navigation

BD™ AbSeq Oligo Hamster Anti-Mouse CD103

Clone 2E7 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Itgae; integrin alpha-E; Integrin αIEL chain; αE; alpha-E1
16407
2 µl
Armenian Hamster IgG2, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CAATATAATAGCCGGTAGGTGTAGTGCGTAATCAGG
AMM2168
Mouse intestinal intraepithelial lymphocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
  8. Please refer to bd.com/genomics-resources for technical protocols.
  9. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940358 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
2E7

The 2E7 monoclonal antibody specifically recognizes CD103 which is also known as the α chain of the heterodimeric αIELβ7 (also known as, αEβ7) integrin. CD103 is a type I transmembrane glycoprotein that is encoded by Itgae (integrin alpha E, epithelial-associated). CD103 has a unique and fairly restricted tissue distribution. It is expressed on almost all intestinal intraepithelial lymphocytes (IEL), dendritic epidermal T cells (DEC), subsets of peripheral T cells, and distinct subsets of fetal, neonatal, and adult thymocytes. E-cadherin is the epithelial cell ligand for αIELβ7 integrin. The ordered expression of αIEL during thymocyte development (which occurs under the influence of the thymic epithelium), high level of αIEL expression on peripheral T cells in epithelial tissues (IEL and DEC), and expression of CD103 on a subset of CD8+ lymphocytes responding to allogeneic epithelial cells, suggest that αIELβ7 integrin has a common role in the interactions of T lymphocytes with epithelia during T-cell maturation and effector functions. CD103 is thought to play a role in allograft rejection. The 2E7 antibody recognizes a different epitope than that recognized by the M290 antibody. Ligation of CD103 by 2E7 reportedly induces intracellular signaling activity in a redirected lysis assay and can costimulate anti-TCR antibody-activated IEL and CD8+ T cells. The 2E7 hamster antibody does not crossreact with rat leucocytes.

940358 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940358 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940358" on CiteAb

개발 참고 자료 (7)

  1. Goodman T, Lefrancois L. Intraepithelial lymphocytes. Anatomical site, not T cell receptor form, dictates phenotype and function. J Exp Med. 1989; 170(5):1569-1581. (Biology). 참조 보기
  2. Hadley GA, Bartlett ST, Via CS, Rostapshova EA, Moainie S. The epithelial cell-specific integrin, CD103 (alpha E integrin), defines a novel subset of alloreactive CD8+ CTL. J Immunol. 1997; 159(8):748-3756. (Biology). 참조 보기
  3. Kilshaw PJ, Murant SJ. A new surface antigen on intraepithelial lymphocytes in the intestine. Eur J Immunol. 1990; 20(10):2201-2207. (Biology). 참조 보기
  4. Kilshaw PJ, Murant SJ. Expression and regulation of beta 7(beta p) integrins on mouse lymphocytes: relevance to the mucosal immune system. Eur J Immunol. 1991; 21(10):2591-2597. (Biology). 참조 보기
  5. Lefrancois L, Barrett TA, Havran WL, Puddington L. Developmental expression of the alpha IEL beta 7 integrin on T cell receptor gamma delta and T cell receptor alpha beta T cells. Eur J Immunol. 1994; 24(3):635-640. (Immunogen: Flow cytometry, Immunohistochemistry, Immunoprecipitation). 참조 보기
  6. Müller S, Jungo M, Aichele P, Mueller C. CD5- CD8 alpha beta intestinal intraepithelial lymphocytes (IEL) are induced to express CD5 upon antigen-specific activation: CD5- and CD5+ CD8 alpha beta IEL do not represent separate T cell lineages.. Eur J Immunol. 1997; 27(7):1756-61. (Clone-specific: Flow cytometry). 참조 보기
  7. Roberts K, Kilshaw PJ. The mucosal T cell integrin alpha M290 beta 7 recognizes a ligand on mucosal epithelial cell lines. Eur J Immunol. 1993; 23(7):1630-1635. (Biology). 참조 보기
모두 보기 (7) 간단히 보기
940358 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.