Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CXCR2

BD™ AbSeq Oligo Rat Anti-Mouse CXCR2

Clone V48-2310 (RUO)

940209
EA (1 Each)
25 Tests
Add Product To Quote견적 추가하기
제품 세부 정보
Down Arrow


BD™ AbSeq
Cxcr2; C-X-C chemokine receptor type 2; Cmkar2; IL-8rb; GRO/MGSA receptor
12765
2 µl
Rat IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTTAGATCGTAGGTTGTTGCATTCGGGAGGTGTTGG
AMM2105
Mouse CD182 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

데이터 시트

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940209 Rev. 2
항체 세부 정보
Down Arrow
V48-2310

The V48-2310 monoclonal antibody specifically recognizes CD182 which is also known as C-X-C chemokine receptor type 2 (CXCR2). CD182 is a seven-transmembrane protein and member of the G protein-coupled receptor 1 family that is encoded by Cxcr2 [Chemokine (C-X-C motif) receptor 2]. CD182 is highly expressed on neutrophils and binds to CXCL1 (KC/GRO-alpha), CXCL2 (MIP2), CXCL3 (Dcip1), CXCL5 (LIX), and CXCL7 (NAP-2). CD182 plays a role in neutrophil activation and trafficking.

940209 Rev. 2
형광 세부 정보
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940209 Rev.2
인용 및 참고 문헌
Down Arrow

개발 참고 자료 (3)

  1. Bachelerie F, Ben-Baruch A, Burkhardt AM, et al. International Union of Basic and Clinical Pharmacology. [corrected]. LXXXIX. Update on the extended family of chemokine receptors and introducing a new nomenclature for atypical chemokine receptors.. Pharmacol Rev. 2014; 66(1):1-79. (Biology). 참조 보기
  2. Bozic CR, Gerard NP, von Uexkull-Guldenband C, et al. The murine interleukin 8 type B receptor homologue and its ligands. Expression and biological characterization.. J Biol Chem. 1994; 269(47):29355-8. (Biology). 참조 보기
  3. Griffith JW, Sokol CL, Luster AD. Chemokines and chemokine receptors: positioning cells for host defense and immunity.. Annu Rev Immunol. 2014; 32:659-702. (Biology). 참조 보기
940209 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.