Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD326

BD™ AbSeq Oligo Rat Anti-Mouse CD326

Clone G8.8

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Ep-CAM; EGP; EGP-2; Egp314; GA733-2; TROP1; Tacsd1; Tacstd1; Ly74; gp40
2 µl
Rat SD, also known as Sprague-Dawley (outbred) IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGAGTTGAGTGGGTTGGTCGAGTAGCGTAAATGTGG
AMM2065
Glycoconjugates from BALB/c mouse-derived TE-71 medullary thymic epithelial cell line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat
Ms CD326 Olgo AMM2065 G8.8 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 mL 카탈로그 No. 554656
sampleImage/
BD Rhapsody™ Scanner RUO
사이즈 1 Each 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 Each 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940169 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
G8.8

The G8.8 monoclonal antibody recognizes CD326/Ep-CAM (Epithelial Cell Adhesion Molecule), also known as gp40 in the mouse and by a variety of names (including GA733-2, CO17-1A, and EGP) in the human.  In the mouse, Ep-CAM is a 40-42 kDa cell-surface type 1 transmembrane glycoprotein expressed on thymic epithelial cells, thymic dendritic cells, immature thymocytes, a small subset of peripheral T lymphocytes, intestinal epithelium, kidney-collecting tubule epithelium, keratinocytes, Langerhans cells and lymph node and splenic dendritic cells. Profiles of Ep-CAM expression on fetal thymocytes and on the CD4[-] CD8[-], CD4[+] CD8[+], CD4[-] CD8[+], and CD4[+] CD8[-] subsets of adult thymocytes have been published.  In unrelated studies, mouse Ep-CAM mRNA was detected in tissues containing epithelial cells (kidney, stomach, intestine, lung, and thymus) and in plasma cells and plasmacytomas, but not in heart, muscle, liver, brain, spleen, B lymphomas, or pre-B lymphomas.  Ep-CAM is a Ca[2+] independent homophilic adhesion molecule that is proposed to play roles in the development and normal function of epithelial tissues and in the progression of carcinomas.

940169 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940169 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (9)

  1. Basak S, Speicher D, Eck S, Wunner W. Colorectal carcinoma invasion inhibition by CO17-1A/GA733 antigen and its murine homologue. J Natl Cancer Inst. 1998; 90(9):691-697. (Biology). 참조 보기
  2. Bergsagel PL, Victor-Kobrin C, Timblin CR, Trepel J, Kuehl WM. A murine cDNA encodes a pan-epithelial glycoprotein that is also expressed on plasma cells. J Immunol. 1992; 148(2):590-596. (Biology). 참조 보기
  3. Birebent B, Somasundaram R, Purev E. Anti-idiotypic antibody and recombinant antigen vaccines in colorectal cancer patients. Crit Rev Oncol Hematol. 2001; 39((1-2)):107-113. (Biology). 참조 보기
  4. Borkowski TA, Nelson AJ, Farr AG, Udey MC. Expression of gp40, the murine homologue of human epithelial cell adhesion molecule (Ep-CAM), by murine dendritic cells. Eur J Immunol. 1996; 26(1):110-114. (Clone-specific: Immunohistochemistry). 참조 보기
  5. Farr A, Nelson A, Truex J, Hosier S. Epithelial heterogeneity in the murine thymus: a cell surface glycoprotein expressed by subcapsular and medullary epithelium. J Histochem Cytochem. 1991; 39(5):345-353. (Immunogen: Electron microscopy, Immunohistochemistry, Immunoprecipitation). 참조 보기
  6. Litvinov SV, Balzar M, Winter MJ. Epithelial cell adhesion molecule (Ep-CAM) modulates cell-cell interactions mediated by classic cadherins. J Biol Chem. 1997; 139(5):1337-1348. (Biology). 참조 보기
  7. Nelson AJ, Dunn RJ, Peach R, Aruffo A, Farr AG. The murine homolog of human Ep-CAM, a homotypic adhesion molecule, is expressed by thymocytes and thymic epithelial cells. Eur J Immunol. 1996; 26(2):401-408. (Clone-specific: Electron microscopy, Immunohistochemistry, Immunoprecipitation). 참조 보기
  8. Taguchi N, Hashimoto Y, Naiki M. Abnormal thymic expression of epithelial cell adhesion molecule (EP-CAM) in New Zealand Black (NZB) mice. J Autoimmun. 1999; 13(4):393-400. (Clone-specific: Electron microscopy). 참조 보기
  9. Zutter MM. Gastrointestinal carcinoma antigen GA733: target for immunodestruction and potential modifier of invasiveness and chemoresponsiveness. J Natl Cancer Inst. 1998; 90(9):642-644. (Biology). 참조 보기
모두 보기 (9) 간단히 보기
940169 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.