Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD172a

BD™ AbSeq Oligo Rat Anti-Mouse CD172a

Clone P84

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Sirpa; Sirp alpha; Sirpα; Bit; SHPS-1; p84; Ptpns1
2 µl
Rat SD, also known as Sprague-Dawley (outbred) IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CGTGGTGAGTTGCGAGTGTGCGTATTATTATCTATG
AMM2097
Membrane fractions from mouse brain
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat
Ms CD172a (SIRPa) Olgo AMM2097 P84 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 mL 카탈로그 No. 554656
sampleImage/
BD Rhapsody™ Scanner RUO
사이즈 1 Each 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 Each 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940201 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
P84

The P84 monoclonal antibody specifically binds to CD172a, also known as SIgnal-Regulatory Protein α (SIRPα), Src Homology 2 domain-containing protein tyrosine Phosphatase (SHP) Substrate 1 (SHPS-1), or Brain Immunoglobulin-like molecule with Tyrosine-based activation motifs (BIT). CD172a is an adhesion molecule of the Ig superfamily which is expressed on neurons in the central nervous system and the retina, on macrophages, and on bone-marrow myeloid cells. Its ligand, CD47, or Integrin-Associated Protein (IAP), is expressed by a wide variety of cells. CD172a and CD47 are proposed to mediate bi-directional signaling to modify neural synaptic activity and regulate the phagocytic activities of macrophages.

940201 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940201 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (7)

  1. Chuang W, Lagenaur CF. Central nervous system antigen P84 can serve as a substrate for neurite outgrowth. Dev Biol. 1990; 137(2):219-232. (Immunogen). 참조 보기
  2. Comu S, Weng W, Olinsky S. The murine P84 neural adhesion molecule is SHPS-1, a member of the phosphatase-binding protein family. J Neurosci. 1997; 17(22):8702-8710. (Biology). 참조 보기
  3. Gresham HD, Dale BM, Potter JW, et al. Negative regulation of phagocytosis in murine macrophages by the Src kinase family member, Fgr. J Exp Med. 2000; 191(3):515-528. (Biology). 참조 보기
  4. Jiang P, Lagenaur CF, Narayanan V. Integrin-associated protein is a ligand for the P84 neural adhesion molecule. J Biol Chem. 1999; 274(2):559-562. (Biology). 참조 보기
  5. Mi ZP, Jiang P, Weng WL, Lindberg FP, Narayanan V, Lagenaur CF. Expression of a synapse-associated membrane protein, P84/SHPS-1, and its ligand, IAP/CD47, in mouse retina. J Comp Neurol. 2000; 416(3):335-344. (Biology). 참조 보기
  6. Oldenborg PA, Zheleznyak A, Fang YF, Lagenaur CF, Gresham HD, Lindberg FP. Role of CD47 as a marker of self on red blood cells. Science. 2000; 288(5473):2051-2054. (Biology). 참조 보기
  7. Veillette A, Thibaudeau E, Latour S. High expression of inhibitory receptor SHPS-1 and its association with protein-tyrosine phosphatase SHP-1 in macrophages. J Biol Chem. 1998; 273(35):22719-22728. (Biology). 참조 보기
모두 보기 (7) 간단히 보기
940201 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.