Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD11a

BD™ AbSeq Oligo Rat Anti-Mouse CD11a

Clone 2D7

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Itgal; Integrin alpha-L; Integrin αL; ITAL; LFA-1A; LFA-1α; Ly-15
16408
2 µl
Rat IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTGTCGTAGTGTTGCAGTATATCGGGTGGGTTGTGT
AMM2091
Not Reported
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat
Ms CD11a Olgo AMM2091 2D7 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 mL 카탈로그 No. 554656
sampleImage/
BD Rhapsody™ Scanner RUO
사이즈 1 Each 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 Each 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940195 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
2D7

The 2D7 monoclonal antibody specifically binds to the 180-kDa αL chain of LFA-1 (CD11a/CD18, αLβ2 integrin), a heterodimeric surface glycoprotein expressed on almost all leukocytes. CD8a+CD8b- intestinal intraepithelial T lymphocytes, which are believed to be thymus independent, do not express CD11a. LFA-1 mediates a variety of heterotypic and homotypic intracellular adhesions through interaction with ICAM-1 (CD54) and ICAM-2 (CD102), including participation in the immunological synapses between CD8+ T lymphocytes and antigen-presenting cells. mAb 2D7 has been reported to block an in vitro allogeneic mixed-leukocyte reaction. The 2D7 and M17/4 (Cat. No. 553337, for the NA/LE™ format) antibodies are reported to recognize different epitopes of the CD11a molecule.

940195 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940195 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (6)

  1. Huleatt JW, Lefrancois L. Beta2 integrins and ICAM-1 are involved in establishment of the intestinal mucosal T cell compartment. Immunity. 1996; 5(3):263-273. (Biology). 참조 보기
  2. Kootstra CJ, Van Der Giezen DM, Van Krieken JH, De Heer E, Bruijn JA. Effective treatment of experimental lupus nephritis by combined administration of anti-CD11a and anti-CD54 antibodies. Clin Exp Immunol. 1997; 108(2):324-332. (Biology). 참조 보기
  3. Larson RS, Springer TA. Structure and function of leukocyte integrins. Immunol Rev. 1990; 114:181-217. (Biology). 참조 보기
  4. Masten BJ, Yates JL, Pollard Koga AM, Lipscomb MF. Characterization of accessory molecules in murine lung dendritic cell function: roles for CD80, CD86, CD54, and CD40L. Am J Respir Cell Mol Biol. 1997; 16(3):335-342. (Clone-specific: Blocking, Flow cytometry). 참조 보기
  5. Potter TA, Grebe K, Freiberg B, Kupfer A. Formation of supramolecular activation clusters on fresh ex vivo CD8+ T cells after engagement of the T cell antigen receptor and CD8 by antigen-presenting cells. Proc Natl Acad Sci U S A. 2001; 98(22):12624-12629. (Biology). 참조 보기
  6. Springer TA. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell. 1994; 76(2):301-314. (Biology). 참조 보기
모두 보기 (6) 간단히 보기
940195 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.