Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD115 (CSF-1R)

BD™ AbSeq Oligo Rat Anti-Mouse CD115 (CSF-1R)

Clone T38-320

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
M-CSFR; M-CSF-R; CSF-1 Receptor; CSF-1R; Csf1r; Csfmr; Fms; c-Fms; Fim-2
12978
2 µl
Rat IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ACGATTGTATGCGAGTGAGGCGAAAGTAGATGGGCT
AMM2094
Mouse CD115 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat
Ms CD115 Olgo AMM2094 T38-320 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 mL 카탈로그 No. 554656
sampleImage/
BD Rhapsody™ Scanner RUO
사이즈 1 Each 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 Each 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940198 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
T38-320

The T38-320 monoclonal antibody specifically binds to CD115 which is also known as Colony stimulating factor 1 Receptor (CSF-1R) or Macrophage colony-stimulating factor 1 receptor (M-CSFR). This type I transmembrane glycoprotein is a receptor tyrosine kinase (RTK) that belongs to the Ig superfamily. It is expressed on a variety of cells including those committed to the mononuclear phagocyte lineage, such as, monocytes, macrophages, and osteoclasts. CSF-1 binds to and signals through CSF-1R homodimers which undergo tyrosine autophosphorylation and transduce downstream signaling pathways resulting in cytoskeletal reorganization and gene expression. CSF-1R activation stimulates the proliferation, differentiation, and survival of cells within the mononuclear phagocyte system.  Interleukin-34 (IL-34) is another ligand for CD115 that can induce similar, as well as, some different biological responses by CD115-positive target cells.

940198 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940198 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (6)

  1. Breslin WL, Strohacker K, Carpenter KC, Haviland DL, McFarlin BK. Mouse blood monocytes: standardizing their identification and analysis using CD115. J Immunol Methods. 2013; 390(1-2):1-8. (Biology). 참조 보기
  2. Fend L, Accart N, Kintz J et al. Therapeutic effects of anti-CD115 monoclonal antibody in mouse cancer models through dual inhibition of tumor-associated macrophages and osteoclasts. PLoS ONE. 2013; 8(9):e73310. (Biology). 참조 보기
  3. Huang B, Pan PY, Li Q et al. Gr-1+CD115+ immature myeloid suppressor cells mediate the development of tumor-induced T regulatory cells and T-cell anergy in tumor-bearing host. Cancer Res. 2006; 15(66):1123-1131. (Biology). 참조 보기
  4. Jin D, Sprent J. GM-CSF Culture Revisited: Preparation of Bulk Populations of Highly Pure Dendritic Cells from Mouse Bone Marrow.. J Immunol. 2018; 201(10):3129-3139. (Clone-specific: Flow cytometry). 참조 보기
  5. Matthes T, Manfroi B, Zeller A, Dunand-Sauthier I, Bogen B, Huard B. Autocrine amplification of immature myeloid cells by IL-6 in multiple myeloma-infiltrated bone marrow.. Leukemia. 2015; 29(9):1882-90. (Clone-specific: Flow cytometry). 참조 보기
  6. Rothwell VM, Rohrschneider LR. Murine c-fms cDNA: cloning, sequence analysis and retroviral expression. Oncogene Res. 1987; 1(4):311-324. (Biology). 참조 보기
모두 보기 (6) 간단히 보기
940198 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.