Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD27

BD™ AbSeq Oligo Mouse Anti-Human CD27

Clone L128

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
TNFRSF7; Tumor necrosis factor receptor superfamily, member 7; Tp55; S152
939
2 µl
Mouse BALB/c IgG1
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CTGTTATTATAGCGAGCGTTGATTTCCGGGTTAGGT
AHS0249
Human Activated Peripheral Blood Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD27 Olgo AHS0249 L128 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940319 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
L128

The L128 monoclonal antibody specifically binds to human CD27. CD27 is a 55-kDa disulfide-linked dimer that is a member of the nerve growth factor (NGF) super family. This family also includes CD40, rat OX40, tumor necrosis factor (TNF) receptors and CD95 (Fas). With its ligand CD70, CD27 acts in a co-stimulatory fashion on T lymphocytes. Present on most peripheral blood T lymphocytes and medullary thymocytes, the CD27 antigen is upregulated upon activation with the release of a soluble form, 28 to 32 kDa. It is also detected on a subpopulation of approximately 33% of circulating B lymphocytes. Following exposure to antigens, CD45RA+ T lymphocytes respond by upregulating the CD27 antigen. After maximal stimulation, the CD27 antigen cannot be re-expressed on long-term cultures or on CD45RA-CD27+ T lymphocytes. The CD4+CD27- population is contained within the memory CD45RO+ subset that proliferates after exposure to allergens. Two subpopulations of B lymphocytes bearing the CD27 antigen secrete IgM (δ+) and IgG (δ-).

940319 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940319 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (12)

  1. Baars PA, Maurice MM, Rep M, Hooibrink B, van Lier RA. Heterogeneity of the circulating human CD4+ T cell population. Further evidence that the CD4+CD45RA-CD27- T cell subset contains specialized primed T cells. J Immunol. 1995; 154(1):17-25. (Biology). 참조 보기
  2. Bowman MR, Crimmins MA, Yetz-Aldape J, Kriz R, Kelleher K, Herrmann S. The cloning of CD70 and its identification as the ligand for CD27. J Immunol. 1994; 152(4):1756-1761. (Biology). 참조 보기
  3. Camerini D, Walz G, Loenen WA, Borst J, Seed B. The T cell activation antigen CD27 is a member of the nerve growth factor/tumor necrosis factor receptor gene family. J Immunol. 1991; 147(9):3165-3169. (Biology). 참조 보기
  4. De Jong R, Brouwer M, Hooibrink B, Van der Pouw-Kraan T, Miedema F, Van Lier RA. The CD27- subset of peripheral blood memory CD4+ lymphocytes contains functionally differentiated T lymphocytes that develop by persistent antigenic stimulation in vivo. Eur J Immunol. 1992; 22(4):993-999. (Biology). 참조 보기
  5. Hintzen RQ, Lens SM, Beckmann MP, Goodwin RG, Lynch D, van Lier RA. Characterization of the human CD27 ligand, a novel member of the TNF gene family. J Immunol. 1994; 152(4):1762-1773. (Biology). 참조 보기
  6. Hintzen RQ, de Jong R, Hack CE, et al. A soluble form of the human T cell differentiation antigen CD27 is released after triggering of the TCR/CD3 complex. J Immunol. 1991; 147(1):29-35. (Biology). 참조 보기
  7. Hintzen RQ, de Jong R, Lens SM, Brouwer M, Baars P, van Lier RA. Regulation of CD27 expression on subsets of mature T-lymphocytes. J Immunol. 1993; 151(5):2426-2435. (Biology). 참조 보기
  8. Kobata T, Agematsu K, Kameoka J, Schlossman SF, Morimoto C. CD27 is a signal-transducing molecule involved in CD45RA+ naive T cell costimulation. J Immunol. 1994; 153(12):5422-5432. (Biology). 참조 보기
  9. Kobata T, Morimoto C. CD27 Workshop Panel Report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:67-69.
  10. Maurer D, Fischer GF, Fae I, et al. IgM and IgG but not cytokine secretion is restricted to the CD27+ B lymphocyte subset. J Immunol. 1992; 148(12):3700-3705. (Biology). 참조 보기
  11. Morimoto C. Cluster report: CD27. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:356-357.
  12. Reiter C. T9. Cluster report: CD27. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:350.
모두 보기 (12) 간단히 보기
940319 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.