Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD122

BD™ AbSeq Oligo Mouse Anti-Human CD122

Clone Mik-β2 (RUO)

940504
EA (1 Each)
25 Tests
Add Product To Quote견적 추가하기
제품 세부 정보
Down Arrow


BD™ AbSeq
IL-2 Receptor β chain; IL2RB; IL-2Rβ; IL15RB; P70-75
3560
2 µl
Mouse IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTTACAGTATTGCGAGCGATGGAACGAGTGATGCCG
AHS0177
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Hu CD122 Olgo AHS0177 MIK-BETA 2 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

데이터 시트

940504 Rev. 2
항체 세부 정보
Down Arrow
Mik-β2

The Mik-β2 monoclonal antibody specifically recognizes the 75 kD β subunit (p75) of the IL-2 receptor (IL-2Rβ). Cell surface IL-2Rβ molecules are expressed by T cells, B cells, monocytes, myeloid precursors, NK cells, and LGL. Together with the α subunit (p55, CD25) and the common γ subunit (CD132; γc subunit of the IL-2R, IL-4R, and IL-7R), the IL-2Rβ molecule forms a high-affinity, signaling receptor complex for IL-2 which can be expressed by activated T and B lymphocytes. Alternatively, some cell types, such as NK cells and myeloid cell populations, coexpress IL-2Rβ molecules and γc subunits to form intermediate-affinity, signalling receptor complexes for IL-2.

940504 Rev. 2
형광 세부 정보
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940504 Rev.2
인용 및 참고 문헌
Down Arrow

개발 참고 자료 (4)

  1. Lin G-X, Yang X, Hollemweguer E, et al. Cross-reactivity of CD antibodies in eight animal species. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:519-523.
  2. Reichert TE, Kashii Y, Stanson J, Zeevi A, Whiteside TL. The role of endogenous interleukin-2 in proliferation of human carcinoma cell lines.. Br J Cancer. 1999; 81(5):822-31. (Clone-specific: Functional assay, Inhibition). 참조 보기
  3. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  4. Tsudo M, Kitamura F, Miyasaka M. Characterization of the interleukin 2 receptor beta chain using three distinct monoclonal antibodies. Proc Natl Acad Sci U S A. 1989; 86(6):1982-1986. (Biology). 참조 보기
940504 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.