Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD80 (B7-1)

BD™ AbSeq Oligo Hamster Anti-Mouse CD80 (B7-1)

Clone 16-10A1

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
Cd80; B7; B7-1; Cd28l; Ly-53; MIC17; TSA1
12519
2 µl
Armenian Hamster IgG2, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGAGAGGGTATATTAGGCGTGCGTAGGAGTTAGTTG
AMM2037
Mouse CD80 (B7) Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster
Ms CD80 Olgo AMM2037 16-10A1 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 mL 카탈로그 No. 554656
sampleImage/
BD Rhapsody™ Scanner RUO
사이즈 1 Each 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 Each 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940141 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
16-10A1

The 16-10A1 monoclonal antibody specifically recognizes CD80 (B7-1). This member of the Ig superfamily, like CD86 (B7-2), can bind to either CD28 or CD152 (CTLA-4) and provide either costimulatory or coinhibitory signals to T cells, respectively. CD80 is constitutively expressed on dendritic cells, monocytes, and peritoneal macrophages as well as by activated B cells and T cells. The 16-10A1 antibody blocks binding of CTLA-4 Ig to CD80 as well as T-cell activation by Con A-elicited peritoneal exudate cells or CD80-transfected cell lines. However, the 16-10A1 antibody alone is not able to block T-cell activation by antigen-presenting cells. The 16-10A1 antibody may reportedly block the binding of another CD80-specific antibody, clone 1G10. In addition, the 16-10A1 antibody may crossreact with an activation antigen expressed on IFN-γ-activated alveolar macrophages of the dog.

940141 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940141 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow

개발 참고 자료 (5)

  1. Bluestone JA. New perspectives of CD28-B7-mediated T cell costimulation. Immunity. 1995; 2(6):555-559. (Biology). 참조 보기
  2. Boussiotis VA, Gribben JG, Freeman GJ, Nadler LM. Blockade of the CD28 co-stimulatory pathway: a means to induce tolerance. Curr Opin Immunol. 1994; 6(5):797-807. (Biology). 참조 보기
  3. Hathcock KS, Laszlo G, Pucillo C, Linsley P, Hodes RJ. Comparative analysis of B7-1 and B7-2 costimulatory ligands: expression and function. J Exp Med. 1994; 180(2):631-640. (Biology). 참조 보기
  4. Razi-Wolf Z, Freeman GJ, Galvin F, Benacerraf B, Nadler L, Reiser H. Expression and function of the murine B7 antigen, the major costimulatory molecule expressed by peritoneal exudate cells. Proc Natl Acad Sci U S A. 1992; 89(9):4210-4214. (Immunogen: Blocking, Immunoprecipitation). 참조 보기
  5. Sojka DK, Donepudi M, Bluestone JA, Mokyr MB. Melphalan and other anticancer modalities up-regulate B7-1 gene expression in tumor cells. J Immunol. 2000; 164(12):6230-6236. (Biology). 참조 보기
940141 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.