Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD54

BD™ AbSeq Oligo Hamster Anti-Mouse CD54

Clone 3E2

(RUO)
제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
ICAM-1; Icam1; Intercellular adhesion molecule 1; Ly-47; MALA-2; MyD10
15894
2 µl
Armenian Hamster IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CGTATAGTGCCGTAGTTGAGTGGTAAATGCGCTTGT
AMM2068
Not reported
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster
Ms CD54 (ICAM-1) Olgo AMM2068 3E2 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 mL 카탈로그 No. 554656
sampleImage/
BD Rhapsody™ Scanner RUO
사이즈 1 Each 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 Each 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940172 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
3E2

The 3E2 monoclonal antibody specifically binds to CD54 (ICAM-1), a 95-kDa member of the Ig superfamily found on lymphocytes, vascular endothelium, high endothelial venules, epithelial cells, macrophages, and dendritic cells. ICAM-1 is a ligand for LFA1 (CD11a/CD18) and Mac-1 (CD11b/CD18). Its expression is upregulated upon stimulation by inflammatory mediators such as cytokines and LPS. Studies with mouse Icam1-transfected antigen-presenting cells, with CD54-blocking antibodies, and in CD54-deficient mice indicate that CD54 participates in inflammatory reactions and antigen-specific immune responses. In addition, there is evidence that CD54 is a receptor involved in MHC-non-restricted responses to weakly immunogenic tumor cells. The 3E2 antibody has been reported to block in vitro and in vivo intracellular adhesion events involved in immune responses.

940172 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940172 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940172" on CiteAb

개발 참고 자료 (12)

  1. Gonzalo JA, Martinez C, Springer TA, Gutierrez-Ramos JC. ICAM-1 is required for T cell proliferation but not for anergy or apoptosis induced by Staphylococcus aureus enterotoxin B in vivo. Int Immunol. 1995; 7(10):1691-1698. (Clone-specific: Flow cytometry). 참조 보기
  2. Isobe M, Yagita H, Okumura K, Ihara A. Specific acceptance of cardiac allograft after treatment with antibodies to ICAM-1 and LFA-1. Science. 1992; 255(5048):1125-1127. (Biology). 참조 보기
  3. Kelly KJ, Williams WW Jr, Colvin RB, et al. Intercellular adhesion molecule-1-deficient mice are protected against ischemic renal injury. J Clin Invest. 1996; 97(4):1056-1063. (Biology). 참조 보기
  4. Masten BJ, Yates JL, Pollard Koga AM, Lipscomb MF. Characterization of accessory molecules in murine lung dendritic cell function: roles for CD80, CD86, CD54, and CD40L. Am J Respir Cell Mol Biol. 1997; 16(3):335-342. (Clone-specific). 참조 보기
  5. Nishio M, Podack ER. Rapid induction of tumor necrosis factor cytotoxicity in naive splenic T cells by simultaneous CD80 (B7.1) and CD54 (ICAM-1) co-stimulation. Eur J Immunol. 1996; 26(9):2160-2164. (Biology). 참조 보기
  6. Nishio M, Spielman J, Lee RK, Nelson DL, Podack ER. CD80 (B7.1) and CD54 (intracellular adhesion molecule-1) induce target cell susceptibility to promiscuous cytotoxic T cell lysis. J Immunol. 1996; 157(10):4347-4353. (Biology). 참조 보기
  7. Scheynius A, Camp RL, Pure E. Reduced contact sensitivity reactions in mice treated with monoclonal antibodies to leukocyte function-associated molecule-1 and intercellular adhesion molecule-1. J Immunol. 1993; 150(2):655-663. (Clone-specific: Flow cytometry, Inhibition, In vivo exacerbation). 참조 보기
  8. Scheynius A, Camp RL, Pure E. Unresponsiveness to 2,4-dinitro-1-fluoro-benzene after treatment with monoclonal antibodies to leukocyte function-associated molecule-1 and intercellular adhesion molecule-1 during sensitization. J Immunol. 1996; 154(5):1804-1809. (Biology). 참조 보기
  9. Siu G, Hedrick SM, Brian AA. Isolation of the murine intercellular adhesion molecule 1 (ICAM-1) gene. ICAM-1 enhances antigen-specific T cell activation. J Immunol. 1989; 143(11):3813-3820. (Biology). 참조 보기
  10. Springer TA. Adhesion receptors of the immune system. Nature. 1990; 346(6283):425-434. (Biology). 참조 보기
  11. Springer TA. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell. 1994; 76(2):301-314. (Biology). 참조 보기
  12. Xu H, Gonzalo JA, St Pierre Y, et al. Leukocytosis and resistance to septic shock in intercellular adhesion molecule 1-deficient mice. J Exp Med. 1994; 180(1):95-109. (Clone-specific: Flow cytometry, Immunohistochemistry). 참조 보기
모두 보기 (12) 간단히 보기
940172 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.