Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD29 (Integrin ß1 chain)

BD™ AbSeq Oligo Hamster Anti-Mouse CD29 (Integrin ß1 chain)

Clone HM β1-1 (RUO)

940158
EA (1 Each)
25 Tests
제품 세부 정보
Down Arrow


BD™ AbSeq
Itgb1; Integrin beta-1; Fnrb; gpIIa; VLA-4 subunit beta
16412
2 µl
Armenian Hamster IgG2, λ1
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATTGTTTGTATGAGCCCGTAGTGCAGGTATCGTTTG
AMM2054
Purified mouse VLA-4
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster
Ms CD29 Olgo AMM2054 HM BETA 1-1 25Tst


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

데이터 시트

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 mL 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EACH 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EACH 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940158 Rev. 2
항체 세부 정보
Down Arrow
HM β1-1

The HM β1-1 monoclonal antibody specifically binds to the 130-kDa integrin β1 chain (CD29). CD29 is expressed on the cell surface as a heterodimer with one of the distinct integrin-α chains. With α1 through α6 (CD49a through CD49f), it forms the VLA-1 through VLA-6 complexes, respectively, and with αv (CD51), it forms αvβ1 integrin. It also associates with the integrin α7 α8, and α9 chains in non-lymphoid tissues. As a result, CD29 has a broad tissue distribution, including lymphocytes, endothelia, smooth muscle, epithelia, and oocytes. This hamster mAb to a mouse leukocyte antigen has been observed to crossreact with similar populations of rat leukocytes. Source of the immunogen was purified mouse VLA-4 (α4β1, CD49d/CD29).

940158 Rev. 2
인용 및 참고 문헌
Down Arrow

개발 참고 자료 (6)

  1. Jacobsen K, Miyake K, Kincade PW, Osmond DG.. Highly restricted expression of a stromal cell determinant in mouse bone marrow in vivo. J Exp Med. 1992; 176(4):927-935. (Biology). 참조 보기
  2. Mendrick DL, Kelly DM. Temporal expression of VLA-2 and modulation of its ligand specificity by rat glomerular epithelial cells in vitro. Lab Invest. 1993; 69(6):690-702. (Clone-specific: Blocking). 참조 보기
  3. Noto K, Kato K, Okumura K, Yagita H. Identification and functional characterization of mouse CD29 with a mAb. Int Immunol. 1995; 7(5):835-842. (Immunogen: Blocking, Immunoprecipitation, Inhibition). 참조 보기
  4. Springer TA. Adhesion receptors of the immune system. Nature. 1990; 346(6283):425-434. (Biology). 참조 보기
  5. Wadsworth SA, Chang AC, Hong MJ, Halvorson MJ, Otto S, Coligan JE. Expression of a novel integrin beta 1 chain epitope and anti-beta 1 antibody-mediated enhancement of fibronectin binding are dependent on the stage of T cell differentiation. J Immunol. 1995; 154(5):2125-2133. (Biology). 참조 보기
  6. Wu X, Miyake K, Medina KL, Kincade PW, Gimble JM. Recognition of murine integrin beta 1 by a rat anti-stromal cell monoclonal antibody. Hybridoma. 1994; 13(5):409-416. (Biology). 참조 보기
모두 보기 (6) 간단히 보기
940158 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.