Skip to main content Skip to navigation
Oligo Rat Anti-Mouse Va2 TCR

BD™ AbSeq Oligo Rat Anti-Mouse Va2 TCR

Clone B20.1 (RUO)

940170
Sign In
$400.00
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
T cell receptor alpha, variable region 2
111660
2 µl
Rat LOU, also known as Louvain, LOU/C, LOU/M IgG2a, λ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTGTTGTGGATTTACGTATGTGGCGATTTGGTGTTC
AMM2066
Soluble αβ TCR from mouse cytotoxic T-cell clone KB5-C20
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940170 Rev. 2
Antibody Details
Down Arrow
B20.1

The B20.1 monoclonal antibody specifically binds to most members of the Vα2 T-cell Receptor (TCR) subfamily in mice having the a, b, and c haplotypes of the Tcrb gene complex. B20.1 antibody may crossreact with Vδ8 TCR, which shares >90% sequence homology with Vα2 TCR. Levels of B20.1+ T cells appear to be influenced by Vα haplotypes. Moreover, the frequencies of Vα2+ CD8+ and CD4+ T cells are influenced by H-2 haplotypes.

940170 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940170 Rev.2
Citations & References
Down Arrow

Development References (3)

  1. Grégoire C, Rebaï N, Schweisguth F, et al. Engineered secreted T-cell receptor alpha beta heterodimers.. Proc Natl Acad Sci USA. 1991; 88(18):8077-81. (Immunogen: Flow cytometry, Immunoprecipitation, Radioimmunoassay). View Reference
  2. Pircher H, Rebaï N, Groettrup M, et al. Preferential positive selection of V alpha 2+ CD8+ T cells in mouse strains expressing both H-2k and T cell receptor V alpha a haplotypes: determination with a V alpha 2-specific monoclonal antibody.. Eur J Immunol. 1992; 22(2):399-404. (Immunogen: Flow cytometry, Immunofluorescence, Immunoprecipitation). View Reference
  3. Tomonari K, Fairchild S, Rosenwasser OA. Influence of viral superantigens on V beta- and V alpha-specific positive and negative selection. Immunol Rev. 1993; 131:131-168. (Methodology). View Reference
940170 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.