Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CXCR2

BD™ AbSeq Oligo Rat Anti-Mouse CXCR2

Clone V48-2310 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Cxcr2; C-X-C chemokine receptor type 2; Cmkar2; IL-8rb; GRO/MGSA receptor
12765
2 µl
Rat IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTTAGATCGTAGGTTGTTGCATTCGGGAGGTGTTGG
AMM2105
Mouse CD182 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940209 Rev. 2
Antibody Details
Down Arrow Up Arrow
V48-2310

The V48-2310 monoclonal antibody specifically recognizes CD182 which is also known as C-X-C chemokine receptor type 2 (CXCR2). CD182 is a seven-transmembrane protein and member of the G protein-coupled receptor 1 family that is encoded by Cxcr2 [Chemokine (C-X-C motif) receptor 2]. CD182 is highly expressed on neutrophils and binds to CXCL1 (KC/GRO-alpha), CXCL2 (MIP2), CXCL3 (Dcip1), CXCL5 (LIX), and CXCL7 (NAP-2). CD182 plays a role in neutrophil activation and trafficking.

940209 Rev. 2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940209" on CiteAb

Development References (3)

  1. Bachelerie F, Ben-Baruch A, Burkhardt AM, et al. International Union of Basic and Clinical Pharmacology. [corrected]. LXXXIX. Update on the extended family of chemokine receptors and introducing a new nomenclature for atypical chemokine receptors.. Pharmacol Rev. 2014; 66(1):1-79. (Biology). View Reference
  2. Bozic CR, Gerard NP, von Uexkull-Guldenband C, et al. The murine interleukin 8 type B receptor homologue and its ligands. Expression and biological characterization.. J Biol Chem. 1994; 269(47):29355-8. (Biology). View Reference
  3. Griffith JW, Sokol CL, Luster AD. Chemokines and chemokine receptors: positioning cells for host defense and immunity.. Annu Rev Immunol. 2014; 32:659-702. (Biology). View Reference
940209 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.