Skip to main content Skip to navigation
Oligo Mouse IgG1, κ Isotype Control
940524
Sign In
$400.00
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD® AbSeq
IgG1, kappa Isotype Control (Anti-KLH)
2 µl/test
Mouse BALB/c IgG1, κ
Single Cell 3' Sequencing (Qualified)
TAATGGAGGTAGGCTTGCGTATGAGTTTCGGCGTTT
AHS0493
Keyhole limpet hemocyanin (KLH)
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for = 30 seconds at 400 g to ensure removal of any contents in the cap/tube threads prior to the first opening.

Please refer to the following CITE-Seq protocols for additional staining instructions:

  • Single Cell Labelling with BD® AbSeq Ab-Oligos (1 to 40-plex) (Doc ID: 23-24262)

  • Single-Cell Labeling with BD® AbSeq Ab-Oligos (41 to 100 plex) (Doc ID: 23-22314)

  • Single Cell Labelling with BD® Single-Cell Multiplexing Kits and BD® AbSeq Ab-Oligos (1 to 40 plex) (Doc ID:23-21339)

  • Single-Cell Labeling with BD® Single-Cell Multiplexing Kits and BD® AbSeq Ab-Oligos (41 to 100 plex) (Doc ID: 23-22354)

  • Single-Cell Labeling with BD® Flex Single-Cell Multiplexing Kits and BD® AbSeq Ab-Oligos (1 plex to 100 plex) (Doc ID:23-24312)

Sequencing reference files can be made using the BD® AbSeq Panel Generator (https://abseq-ref-gen.genomics.bd.com/).

Use standard laboratory safety protocols. Read and understand the safety data sheets (SDSs) before handling chemicals. To obtain SDSs, go to regdocs.bd.com or contact BD Biosciences technical support at scomix@bd.com.

Warning: All biological specimens and materials contacting them are considered biohazardous. Handle as if capable of transmitting infection and dispose of with proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves.

Product Notices

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  4. For U.S. patents that may apply, see bd.com/patents.
  5. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction. For best results, close caps securely after use and before storage.
  6. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing. Follow state and local guidelines when disposing of hazardous waste.
  7. Please refer to https://www.bdbiosciences.com/en-us/resources/protocols/single-cell-multiomics for technical protocols.

Data Sheets

940524 Rev. 1
Antibody Details
Down Arrow
X40

The X40 hybridoma was derived from the fusion of mouse Sp2/0-Ag 14 myeloma cells with spleen cells from BALB/c mice immunized with keyhole limpet hemocyanin (KLH). The hybridoma secretes monoclonal antibody that binds specifically to KLH, an antigen not expressed on human cells or human cell lines.

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for various sequencing platforms.  

NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument or BD Rhapsody™ HT Xpress Instrument.

940524 Rev. 1
Format Details
Down Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940524 Rev.1
Citations & References
Down Arrow

Development References (3)

  1. Centers for Disease Control. Update: universal precautions for prevention of transmission of human immunodeficiency virus, hepatitis B virus, and other bloodborne pathogens in healthcare settings. MMWR. 1988; 37:377-388. (Biology).
  2. Clinical and Laboratory Standards Institute. 2005. (Biology).
  3. van Vugt MJ, van den Herik-Oudijk IE, van de Winkle JG. Binding of PE-CY5 conjugates to the human high-affinity receptor for IgG (CD64). Blood. 1996; 88(6):2358-2361. (Biology). View Reference
940524 Rev. 1

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.