Skip to main content Skip to navigation
Oligo Mouse Anti-Stat6 (pY641)

BD® AbSeq Oligo Mouse Anti-Stat6 (pY641)

Clone 18/P-Stat6 (RUO)

940516
Sign In
$400.00
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD® AbSeq
Signal transducer and activator of transcription 6; IL-4 Stat
6778
2 µl/test
Mouse IgG2a
Human (Tested in Development)
Single Cell 3' Sequencing Intracellular CITE-seq (Tested During Development)
AAGCGTTGATTGATTAGCGGTAGTTGAAAGGATTGC
AHS482
Phosphorylated Human Stat6 (pY641)
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for = 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

When using BD® AbSeq intracellular markers with the Single Cell 3' Sequencing Intracellular CITE-seq, cells must first be fixed and permeabilized using the BD Rhapsody™ Intracellular AbSeq Buffer Kit before the antibody-oligo can bind to the protein. Refer to the list of required companion products below and see BD Rhapsody™ System Single-Cell Labelling with BD® AbSeq Ab-Oligos for Intracellular CITE-seq (Doc ID: 23-24464) for the complete BD® AbSeq intracellular multiomics staining protocol. Contact your local Field Application Specialist (FAS) for additional guidance.

Use standard laboratory safety protocols. Read and understand the safety data sheets (SDSs) before handling chemicals. To obtain SDSs, go to regdocs.bd.com or contact BD Biosciences technical support at scomix@bdscomix.bd.com.

Warning: All biological specimens and materials contacting them are considered biohazardous. Handle as if capable of transmitting infection and dispose of with proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves.

Product Notices

  1. Please refer to www.bdbiosciences.com/us/s/resources for technical protocols.
  2. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. Illumina is a trademark of Illumina, Inc.
  9. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940516 Rev. 2
Antibody Details
Down Arrow
18/P-Stat6

Interleukin-4 (IL-4), a major immunoregulatory cytokine, is secreted by activated T lymphocytes, basophils, and mast cells and plays an important role in modulating T helper cell lineage development. It induces specific gene expression via the tyrosine phosphorylation of Stat6 at tyrosine 641 (Y641). Stat6, a member of the signal transducers and activators of transcription protein family, mediates signals for IL-4 and, possibly, IL-13. While Stat6 is widely expressed in human tissues, it exhibits elevated expression in peripheral blood lymphocytes, colon, intestine, ovary, prostate, thymus, spleen, kidney, liver, lung, and placenta. Following cytokine receptor ligation, Jak kinases are activated and phosphorylate the cytoplasmic tails of the oligomerized receptors. The SH3:SH2 domain of Stat6 associates with tyrosine-phosphorylated IL-4 receptor and the proximal Jak kinase phosphorylates Stat6 at Y641 on the C-terminal side of the SH2 domain. Stat6 is then released from the receptor, dimerizes, and is thought to contact the basal transcription machinery by binding to p300/CBP. Thus, Stat6 mediates the IL-4 signal and is essential for the proper development of adaptive immunity.

940516 Rev. 2
Citations & References
Down Arrow

Development References (10)

  1. Bromberg J, Darnell JE. The role of STATs in transcriptional control and their impact on cellular function. Oncogene. 2000; 19(21):2468-2473. (Biology). View Reference
  2. Christophi GP, Panos M, Hudson CA, et al. Macrophages of multiple sclerosis patients display deficient SHP-1 expression and enhanced inflammatory phenotype.. Lab Invest. 2009; 89(7):742-59. (Clone-specific: Flow cytometry). View Reference
  3. Dent AL, Hu-Li J, Paul WE, Staudt LM. T helper type 2 inflammatory disease in the absence of interleukin 4 and transcription factor STAT6. Proc Natl Acad Sci U S A. 1998; 95(23):13823-13828. (Biology). View Reference
  4. Heim MH. The Jak-STAT pathway: specific signal transduction from the cell membrane to the nucleus. Eur J Clin Invest. 1996; 26(1):1-12. (Biology). View Reference
  5. Hou J, Schindler U, Henzel WJ, Ho TC, Brasseur M, McKnight SL. An interleukin-4-induced transcription factor: IL-4 Stat. Science. 1994; 265(5179):1701-1706. (Biology). View Reference
  6. Irish JM, Myklebust JH, Alizadeh AA, et al. B-cell signaling networks reveal a negative prognostic human lymphoma cell subset that emerges during tumor progression.. Proc Natl Acad Sci U S A. 2010; 107(29):12747-12754. (Clone-specific: Flow cytometry). View Reference
  7. Krutzik PO, Nolan GP. Intracellular phospho-protein staining techniques for flow cytometry: monitoring single cell signaling events. Cytometry A. 2003; 55(2):61-70. (Clone-specific: Flow cytometry). View Reference
  8. Mikita T, Campbell D, Wu P, Williamson K, Schindler U. Requirements for interleukin-4-induced gene expression and functional characterization of Stat6. Mol Cell Biol. 1996; 16(10):5811-5820. (Biology). View Reference
  9. Quelle FW, Shimoda K, Thierfelder W, et al.. Cloning of murine Stat6 and human Stat6, Stat proteins that are tyrosine phosphorylated in responses to IL-4 and IL-3 but are not required for mitogenesis. Mol Cell Biol. 1995; 15(6):3336-3343. (Biology). View Reference
  10. Suni MA, Maino VC. Flow cytometric analysis of cell signaling proteins. Methods Mol Biol. 2011; 717:155-169. (Clone-specific: Flow cytometry). View Reference
View All (10) View Less
940516 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.