Skip to main content Skip to navigation
Hamburger Menu
Search icon
Mini Cart
Empty CartYou are not signed in.
Order lookup icon Order lookup icon
Order Lookup
Country Selector Country Selector
United States (English)
Profile Icon Profile Icon
Sign-in/Register UserName
Mini Cart
Empty CartYou are not signed in.
Products

Link Arrow
Solutions

Link Arrow
Discover & Learn

Link Arrow
Resources & Tools

Link Arrow
Support

Link Arrow
Search icon Search icon
Close Menu
    Mini Cart
    Empty CartYou are not signed in.
    Expand menu Expand menu
      Loading...
      Alert Icon
      Oligo Mouse Anti-Human NCAM-1 (CD56)

      BD™ AbSeq Oligo Mouse Anti-Human NCAM-1 (CD56)

      Clone R19-760 (RUO)

      940469
      Sign In
      $400.00
      EA (1 Each)
      25 Tests
      Add to Cart IconAdd to Cart
      Save To Shopping ListRequest Bulk Reagent Quote
      Product Details
      Down Arrow


      BD™ AbSeq
      N-CAM-1, Neural cell adhesion molecule 1; NKH1; MSK39; Leu-19
      4684
      2 µl
      Mouse IgG1, κ
      Human (Tested in Development)
      Single Cell 3' Sequencing (Qualified)
      TGTTTGGCGTGTATGTCTTGTCGTCGAGGTGGAATT
      AHS0240
      Human NCAM1 Recombinant Protein
      Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
      RUO
      Mouse


      Preparation And Storage

      Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
      Show More blue down arrow Show Less blue up arrow

      Recommended Assay Procedures

      Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

      BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

      Show More blue down arrow Show Less blue up arrow

      Product Notices

      1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
      2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
      3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
      4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
      5. Illumina is a trademark of Illumina, Inc.
      6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
      7. Please refer to bd.com/genomics-resources for technical protocols.
      8. For U.S. patents that may apply, see bd.com/patents.
      Show More blue down arrow Show Less blue up arrow

      Data Sheets

      DownloadTechnical Data Sheet (TDS)DownloadSafety Data Sheet
      940469 Rev. 2
      Antibody Details
      Down Arrow
      R19-760

      The R19-760 monoclonal antibody specifically binds to NCAM-1 (Neural cell adhesion molecule 1) that is also known as CD56 and NKH1. NCAM-1 is a heavily glycosylated transmembrane protein and a member of the Ig supergene family. NCAM-1 represents an isoform of the neural cell adhesion molecule (NCAM). In the hematopoietic system, it is present on approximately 10% to 25% of peripheral blood lymphocytes. It is expressed on natural killer (NK) cells and a subset of T cells, NKT cells. It is not expressed on myeloid cells, erythrocytes or B cells. This molecule appears to function as an adhesion molecule and can serve as a panspecific NK-cell marker. The R19-760 antibody recognizes an epitope in the NCAM-1 (CD56) extracellular domain that resists destruction due to cellular fixation with BD Phosflow™ Lyse/Fix Buffer and permeabilization with BD Phosflow™ Perm Buffer III.

      940469 Rev. 2
      Citations & References
      Down Arrow

      Development References (4)

      1. Campbell JJ, Qin S, Unutmaz D, et al. Unique subpopulations of CD56+ NK and NK-T peripheral blood lymphocytes identified by chemokine receptor expression repertoire. J Immunol. 2001; 166(11):6477-6482. (Biology). View Reference
      2. Fornara C, Furione M, Arossa A, Gerna G, Lilleri D. Comparative magnitude and kinetics of human cytomegalovirus-specific CD4⁺ and CD8⁺ T-cell responses in pregnant women with primary versus remote infection and in transmitting versus non-transmitting mothers: Its utility for dating primary infection in pregnancy.. J Med Virol. 2016; 88(7):1238-46. (Clone-specific: Flow cytometry). View Reference
      3. Hsieh CY, Chen CL, Lin YS, et al. Macrophage migration inhibitory factor triggers chemotaxis of CD74+CXCR2+ NKT cells in chemically induced IFN-γ-mediated skin inflammation.. J Immunol. 2014; 193(7):3693-703. (Clone-specific: Flow cytometry). View Reference
      4. Ritz J, Trinchieri G, Lanier LL. NK-cell Antigens: Section Report. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:1367-1372.
      940469 Rev. 2

      Please refer to Support Documents for Quality Certificates

       

      Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

       

      Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

      For Research Use Only. Not for use in diagnostic or therapeutic procedures.