Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD62E

BD™ AbSeq Oligo Mouse Anti-Human CD62E

Clone 68-5H11 (RUO)

612169
Sign In
$566.00
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
SELE; E-selectin; Selectin E; ELAM; ELAM1; ESEL; LECAM2
6401
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGAGAGGAGTAGGTCGACAGTTTAAGGCGCAGAAGT
AHS0254
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940377 Rev. 2
Antibody Details
Down Arrow
68-5H11

The 68-5H11 monoclonal antibody specifically binds to CD62E. This adhesion molecule is a 97-115 kDa type I transmembrane glycoprotein that is encoded by the SELE gene. CD62E is also known as E-selectin, Endothelial-leukocyte adhesion molecule-1 (ELAM-1), and Leukocyte endothelial cell adhesion molecule 2 (LECAM-2). CD62E is minimally expressed by unstimulated endothelium. Activated endothelial cells upregulate surface CD62E expression in response to various activators including inflammatory cytokines such as Interleukin-1 and Tumor Necrosis Factor. CD62E plays a role in leucocyte extravasation by promoting leucocyte rolling on activated endothelial cells during inflammation. CD62E may also play a role in the metastasis of certain tumor cells. The adhesion between endothelial CD62E molecules and a carbohydrate ligand on neutrophils is inhibited by the mAb 68-5H11.

940377 Rev. 2
Citations & References
Down Arrow

Development References (5)

  1. Bevilacqua MP, Stengelin S, Gimbrone MA Jr, Seed B. Endothelial leukocyte adhesion molecule 1: an inducible receptor for neutrophils related to complement regulatory proteins and lectins. Science. 1989; 243(4895):1160-1165. (Biology). View Reference
  2. Goda K, Tanaka T, Takeuchi E, Miyasaka M. CD62E Workshop Panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:416-418.
  3. Phillips ML, Nudelman E, Gaeta FC, et al. ELAM-1 mediates cell adhesion by recognition of a carbohydrate ligand, sialyl-Lex. Science. 1990; 250(4984):1130-1132. (Biology). View Reference
  4. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  5. Vermont-Desroches C, Roy C, Marchand D, Wijdenes J. CD62E Workshop: The Workshop "CD62E," CD62L," "CD102" and "CD106" monoclonal antibodies: Analysis of the monoclonal antibody specificity, epitope mapping, and biological activity. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:418-419.
940377 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.