Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD314 (NKG2D)

BD™ AbSeq Oligo Mouse Anti-Human CD314 (NKG2D)

Clone 1D11 (RUO)

940061
Sign In
$400.00
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
CD314; KLRK1; KLR; NKG2D; NKG2-D; NK cell receptor D
22914
2 µl
Mouse RBF/ DnJ IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTGAAATGCGATGAGACGTAGAGCGATGTAGGTAGC
AHS0065
NKL cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940061 Rev. 3
Antibody Details
Down Arrow
1D11

The 1D11 monoclonal antibody specifically binds to NKG2D, a 42 kDa type II transmembrane glycoprotein that is also known as CD314 and KLRK1. NKG2D is a member of the C-type lectin family and is expressed on human NK cells. This activating receptor binds strongly to several ligands including MICA and MICB and ULBP-1, -2, and -3 proteins that are expressed by different target cell types. Different from natural cytotoxicity receptor (NCR), NKG2D expression is not confined to NK cells. It is also expressed on virtually all TCR γ/δ+ and CD8+TCR α/β+ T cells. NKG2D functions as a triggering receptor involved in natural cytotoxicity mediated by normal NK cells against a variety of tumors or normal target cells. Importantly, NKG2D can complement the role of NCR in tumor cell lysis. Remarkably, the combined maskings of NCR and NKG2D can reportedly lead to a complete inhibition of NK-mediated lysis of all tumor or normal cells. The 1D11 antibody can reportedly block or stimulate the function of NKG2D-positive cells.

940061 Rev. 3
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940061 Rev.3
Citations & References
Down Arrow

Development References (5)

  1. Bauer S, Groh V, Wu J, et al. Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science. 1999; 285(5428):727-729. (Immunogen: Blocking, Flow cytometry, Functional assay, Immunoprecipitation, Inhibition). View Reference
  2. Groh V, Bruhl A, El-Gabalawy H, Nelson JL, Spies T. Stimulation of T cell autoreactivity by anomalous expression of NKG2D and its MIC ligands in rheumatoid arthritis. Proc Natl Acad Sci U S A. 2003; 100(16):9452-9457. (Clone-specific: Flow cytometry, Immunohistochemistry). View Reference
  3. Groh V, Rhinehart R, Randolph-Habecker J, Topp MS, Riddell SR, Spies T. Costimulation of CD8alphabeta T cells by NKG2D via engagement by MIC induced on virus-infected cells. Nat Immunol. 2001; 2(3):255-260. (Clone-specific: Blocking, (Co)-stimulation, Immunohistochemistry, Inhibition). View Reference
  4. Roberts AI, Lee L, Schwarz E, et al. NKG2D receptors induced by IL-15 costimulate CD28-negative effector CTL in the tissue microenvironment. J Immunol. 2001; 167(10):5527-5530. (Clone-specific: Flow cytometry, Stimulation). View Reference
  5. Steinle A, Li P, Morris DL, et al. Interactions of human NKG2D with its ligands MICA, MICB, and homologs of the mouse RAE-1 protein family. Immunogenetics. 2001; 53(4):279-287. (Clone-specific: Blocking). View Reference
940061 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.