Skip to main content Skip to navigation
Oligo Mouse Anti-Human CCR7 (CD197)

BD™ AbSeq Oligo Mouse Anti-Human CCR7 (CD197)

Clone 2-L1-A (RUO)

940394
Sign In
$400.00
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
BLR2; CC chemokine receptor 7; CMKBR7; EBI1; EVI1; Epstein-Barr virus induced gene 1; MIP-3 beta receptor
1236
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AATGTGTGATCGGCAAAGGGTTCTCGGGTTAATATG
AHS0273
Human CCR7 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940394 Rev. 2
Antibody Details
Down Arrow
2-L1-A

The 2-L1-A monoclonal antibody specifically binds to the human CC chemokine receptor CCR7, also known as CD197, on the cell surface. CCR7 (previously known as BLR2, EBI1 and CMKBR7) is a seven-transmembrane, G-protein-coupled receptor specific for two CC chemokines: CCL19 (also known as MIP-3β, Exodus-3, and ELC) and CCL21 (also known as 6Ckine, Exodus-2 SLC, TCA4, and SCYA21). CCR7 mRNA is expressed mainly in lymphoid tissues including the spleen, lymph nodes and tonsil, in bone marrow, and on peripheral T and B lymphocytes, cord blood CD34-positive cells, and mature dendritic cells. In response to its cognate chemokines, CCR7 (CD197) mediates homing of leucocytes to secondary lymphoid tissues. Differential CCR7 (CD197) expression can be used to distinguish naive, central memory, and effector memory T cell subsets. The human CCR7 gene, unlike other CC chemokine receptor genes, has been mapped to chromosome 17 (region 17q12). Because the extracellular region of CCR2 (CD192) has significant sequence homology with CCR7 (CD197), BD Biosciences has confirmed that mAb 2-L1-A does not cross-react with CCR2 on the surface of transfected cells.

940394 Rev. 2
Format Details
Down Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940394 Rev.2
Citations & References
Down Arrow

Development References (8)

  1. Birkenbach M, Josefsen K, Yalamanchili R, Lenoir G, Kieff E. Epstein-Barr virus-induced genes: first lymphocyte-specific G protein-coupled peptide receptors. Nature. 1993; 67(4):2209-2220. (Biology). View Reference
  2. Burgstahler R, Kempkes B, Steube K, Lipp M. Expression of the chemokine receptor BLR2/EBI1 is specifically transactivated by Epstein-Barr virus nuclear antigen 2. Biochem Biophys Res Commun. 1995; 215(2):737-743. (Biology). View Reference
  3. Kim CH, Pelus LM, White JR, Broxmeyer HE. Macrophage-inflammatory protein-3 beta/EBI1-ligand chemokine/CK beta-11, a CC chemokine, is a chemoattractant with a specificity for macrophage progenitors among myeloid progenitor cells. J Immunol. 1998; 161(5):2580-2585. (Biology). View Reference
  4. Schweickart VL, Raport CJ, Godiska R, et al. Cloning of human and mouse EBI1, a lymphoid-specific G-protein-coupled receptor encoded on human chromosome 17q12-q21.2. Genomics. 1994; 23(3):643-650. (Biology). View Reference
  5. Yanagihara S, Komura E, Nagafune J, Watarai H, Yamaguchi Y. EBI1/CCR7 is a new member of dendritic cell chemokine receptor that is up-regulated upon maturation. J Immunol. 1998; 161(6):3096-3102. (Biology). View Reference
  6. Yoshida R, Imai T, Hieshima K, et al. Molecular cloning of a novel human CC chemokine EBI1-ligand chemokine that is a specific functional ligand for EBI1, CCR7. J Biol Chem. 1997; 272(21):13803-13809. (Biology). View Reference
  7. Yoshida R, Nagira M, Imai T, et al. EBI1-ligand chemokine (ELC) attracts a broad spectrum of lymphocytes: activated T cells strongly up-regulate CCR7 and efficiently migrate toward ELC. Int Immunol. 1998; 10(7):901-910. (Biology). View Reference
  8. Yoshida R, Nagira M, Kitaura M, Imagawa N, Imai T, Yoshie O. Secondary lymphoid-tissue chemokine is a functional ligand for the CC chemokine receptor CCR7. J Biol Chem. 1998; 273(12):7118-7122. (Biology). View Reference
View All (8) View Less
940394 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.