Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD49b (Integrin a2 chain)

BD™ AbSeq Oligo Hamster Anti-Mouse CD49b (Integrin a2 chain)

Clone HMα2 (RUO)

640116
Sign In
$183.00
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Integrin α2 chain
16398
2 µl
Armenian Hamster IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGCGGGAAGCGTGTTAACCTATAGTATGATCAAGCG
AMM2034
Mouse colon carcinoma cell line Colon26
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940138 Rev. 2
Antibody Details
Down Arrow
HMα2

The HMα2 antibody reacts with integrin α2 chain (CD49b), the 150-kDa transmembrane glycoprotein that non-covalently associates with the integrin β1 subunit (CD29) to form the integrin α2β1 complex known as VLA-2. VLA-2, a receptor for collagen and laminin, is expressed on some splenic CD4+ T lymphocytes and NK-T cells, intestinal intraepithelial and lamina propria lymphocytes, splenic NK cells, epithelial cells, and platelets; but it is not on thymocytes or Peyer's-patch or lymphnode lymphocytes. The expression of VLA-2 is upregulated on lymphocytes in response to mitogens. The HMα2 antibody has been reported to partially block the interaction of T-cell blasts, but not NK cells, with collagen. Purified HMα2 mAb blocks the staining of splenic NK cells by the anti-CD49b/Pan-NK Cells mAb DX5 (Cat. No. 553858, for the PE conjugate). Therefore, mAb HMα2 may be used like the DX5 mAb for identification of NK cells.

940138 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940138 Rev.2
Citations & References
Down Arrow

Development References (5)

  1. Arase H, Saito T, Phillips JH, Lanier LL. Cutting edge: the mouse NK cell-associated antigen recognized by DX5 monoclonal antibody is CD49b (alpha 2 integrin, very late antigen-2). J Immunol. 2001; 167(3):1141-1144. (Biology). View Reference
  2. Chen H, Paul WE. A population of CD62Llow Nk1.1- CD4+ T cells that resembles NK1.1+ CD4+ T cells. Eur J Immunol. 1998; 28(10):3172-3182. (Biology). View Reference
  3. Miyake S, Sakurai T, Okumura K, Yagita H. Identification of collagen and laminin receptor integrins on murine T lymphocytes. Eur J Immunol. 1994; 24(9):2000-2005. (Immunogen). View Reference
  4. Noto K, Kato K, Okumura K, Yagita H. Identification and functional characterization of mouse CD29 with a mAb. Int Immunol. 1995; 7(5):835-842. (Biology). View Reference
  5. Tanaka T, Ohtsuka Y, Yagita H, Shiratori Y, Omata M, Okumura K. Involvement of alpha 1 and alpha 4 integrins in gut mucosal injury of graft-versus-host disease. Int Immunol. 1995; 7(8):1183-1189. (Biology). View Reference
940138 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.