Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD166

BD™ AbSeq Oligo Mouse Anti-Human CD166

Clone 3A6

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
ALCAM; Activated leucocyte cell adhesion molecule; MEMD
214
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAGAGCGGCGATTGAAGACTGGTACGTATTTAGGTG
AHS0260
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to bd.com/genomics-resources for technical protocols.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940382 Rev. 2
Antibody Details
Down Arrow Up Arrow
3A6

The 3A6 monoclonal antibody specifically binds to the activated leukocyte cell adhesion molecule (ALCAM), a 100-105 kDa transmembrane glycoprotein, also known as the CD6 ligand, CD166. It is composed of an immunoglobulin-like extracellular domain, a transmembrane region and a short cytoplasmic tail. ALCAM belongs to the Ig superfamily of proteins and is expressed on neurons, activated T cells, activated monocytes, epithelial cells and fibroblasts. CD166 plays an important role in mediating adhesion interactions between thymic epithelial cells and CD6+ cells during intrathymic T-cell development.

940382 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940382 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (5)

  1. Aruffo A, Bowen MA, Patel DD, et al. CD6-ligand interactions: a paradigm for SRCR domain function?. Immunol Today. 1997; 18(10):498-504. (Biology). View Reference
  2. Bowen MA, Bajorath J, Aruffo A. CD166 (ALCAM) Workshop Panel Report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:459-461.
  3. Bowen MA, Patel DD, Li X, et al. Cloning, mapping, and characterization of activated leukocyte-cell adhesion molecule (ALCAM), a CD6 ligand. J Exp Med. 1995; 181(6):2213-2220. (Biology). View Reference
  4. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  5. Patel DD, Wee SF, Whichard LP, et al. Identification and characterization of a 100-kD ligand for CD6 on human thymic epithelial cells. J Exp Med. 1995; 181(4):1563-1568. (Biology). View Reference
940382 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.