Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD86

BD™ AbSeq Oligo Mouse Anti-Human CD86

Clone BU63 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
B7.2; B7-2; B-lymphocyte activation antigen B7-2; B70; CD28LG2; LAB72
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGTTTGGTAGAATGGTAAGACGGGAATAGCGATGGT
AHS0245
Human ARH 77 Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940315 Rev. 2
Antibody Details
Down Arrow Up Arrow
BU63

The BU63 monoclonal antibody specifically recognizes CD86 which is also known as B70, B7-2, B7.2, LAB72 or CD28LG2. CD86 is a ~70-80 kDa type I transmembrane glycoprotein that belongs to the Ig gene superfamily. CD86 is expressed on monocytes, dendritic cells, Langerhans cells, activated B cells, and memory B cells. Like CD80 (B7-1), CD86 serves as a ligand for CD28 or CD152 (CTLA-4) expressed by T cells and can induce costimulatory or coinhibitory signals, respectively. The BU63 antibody can reportedly block the binding of other human CD86-specific antibodies including the 2331 (FUN-1) (complete block) or IT2.2 (partial block) antibodies. These results suggest that the BU63 antibody may bind to a similar or identical CD86 epitope as the 2331 (FUN-1) antibody but to a different, although spatially-related epitope compared with the IT2.2 antibody.

940315 Rev. 2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940315" on CiteAb

Development References (5)

  1. Azuma M, Ito D, Yagita H, et al. B70 antigen is a second ligand for CTLA-4 and CD28.. Nature. 1993; 366(6450):76-9. (Biology). View Reference
  2. Engel P, Gribben JG, Freeman GJ, et al. The B7-2 (B70) costimulatory molecule expressed by monocytes and activated B lymphocytes is the CD86 differentiation antigen. Blood. 1994; 84(5):1402-1407. (Clone-specific: Blocking, Flow cytometry). View Reference
  3. Engel P, Wagner N, Tedder TF. CD86 Workshop Report. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:703-705.
  4. Hardie DL, Casamayor M, Johnson GD, et al. CD86 Workshop Panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:201-204.
  5. Nozawa Y, Abe M, Wakasa H. Three mAb, FUN-1, FB1, and FB21, that recognize B-cell antigens in frozen or paraffin-embedded tissue sections. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:705-706.
940315 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.