Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD142

BD™ AbSeq Oligo Mouse Anti-Human CD142

Clone HTF-1 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Tissue factor; TF; TFA; Coagulation factor III; F3; Thromboplastin
2152
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGGGATAGGTAAACGACGACGGAAATGACGGAAACG
AHS0202
Human Tissue Factor Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940280 Rev. 2
Antibody Details
Down Arrow Up Arrow
HTF-1

The HTF-1 monoclonal antibody specifically binds to CD142. CD142 is a 45-47 kDa, single chain, type I transmembrane glycoprotein also known as Tissue Factor (TF). CD142 has been referred in the literature as coagulation Factor III or thromboplastin and it is expressed on activated endothelial cells and lipopolysaccharide (LPS)-stimulated monocytes/macrophages. TF associates with factor VIIa to form a complex and acts as an enzyme that initiates the blood coagulation cascade. It is known as the major initiator of clotting in normal hemostasis. CD142 can be induced by various inflammatory mediators in monocytes and vascular endothelial cells. This antibody is useful in inflammation, thrombosis and hemostasis research.

940280 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940280 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940280" on CiteAb

Development References (5)

  1. Carson SD, Perry GA, Pirruccello SJ. Fibroblast tissue factor: calcium and ionophore induce shape changes, release of membrane vesicles, and redistribution of tissue factor antigen in addition to increased procoagulant activity. Blood. 1994; 84(2):526-534. (Clone-specific: Fluorescence microscopy, Immunofluorescence). View Reference
  2. Carson SD, Ross SE, Bach R, Guha A. An inhibitory monoclonal antibody against human tissue factor.. Blood. 1987; 70(2):490-3. (Immunogen: Dot Blot, ELISA, Flow cytometry, Inhibition, Western blot). View Reference
  3. McComb RD, Miller KA, Carson SD. Tissue factor antigen in senile plaques of Alzheimer's disease. Am J Pathol. 1991; 139(3):491-494. (Clone-specific: Immunohistochemistry). View Reference
  4. Morrissey JH, Agis H, Albrecht S, et al. CD142 (tissue factor) Workshop Panel report. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:742-746.
  5. Whittle SM, Yoder SC, Carson SD. Human placental tissue factor: protease susceptibility of extracellular and cytoplasmic domains. Thromb Res. 1995; 79(5-6):451-459. (Clone-specific: Western blot). View Reference
940280 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.