Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD11c

BD™ AbSeq Oligo Mouse Anti-Human CD11c

Clone B-ly6 (RUO)

940024
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
ITGAX; AlphaX integrin chain; Axb2; Integrin alpha-X; CR4; Leu M5; SLEB6
3687
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATGCGTTGCGAGAGATATGCGTAGGTTGCTGATTGG
AHS0056
Spleen Cells from Human with Hairy Cell Leukemia
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940024 Rev. 3
Antibody Details
Down Arrow
B-ly6

The B-ly6 monoclonal antibody specifically binds to the 150 kDa adhesion glycoprotein CD11c (p150, integrin α chain). CD11c is expressed on dendritic cells, monocytes, macrophages, granulocytes, NK cells and subsets of B and T cells. It associates with CD18 to form the CD11c/CD18 complex that binds fibrinogen and has been reported to be a receptor for iC3b and ICAM-1. Reports indicate that CD11c/CD18 plays a role as an adhesion molecule that mediates cellular binding to ligands expressed on stimulated epithelium and endothelium.

940024 Rev. 3
Citations & References
Down Arrow

Development References (4)

  1. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  2. Stacker SA, Springer TA. Leukocyte integrin P150,95 (CD11c/CD18) functions as an adhesion molecule binding to a counter-receptor on stimulated endothelium. J Immunol. 1991; 146(2):648-655. (Clone-specific: ELISA). View Reference
  3. Visser L, Shaw A, Slupsky J, Vos H, Poppema S. Monoclonal antibodies reactive with hairy cell leukemia. Blood. 1989; 74(1):320-325. (Immunogen: Immunocytochemistry (cytospins), Immunohistochemistry, Immunoprecipitation). View Reference
  4. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
940024 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.