Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD106

BD™ AbSeq Oligo Mouse Anti-Human CD106

Clone 51-10C9 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
VCAM-1; Vascular cell adhesion protein 1; INCAM-100; L1CAM
7412
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TCTGATTTAGCGGGTGGACGTATTATAGTGATTGGC
AHS0251
Human VCAM-1 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940375 Rev. 2
Antibody Details
Down Arrow Up Arrow
51-10C9

The 51-10C9 monoclonal antibody specifically binds to CD106. CD106 is a 100-110 kDa type I transmembrane sialoglycoprotrein that is also known as Vascular cell adhesion molecule-1 (VCAM-1) and INCAM-110. CD106 is expressed at high levels on the surface of cytokine-stimulated endothelium, and at minimal levels on unstimulated endothelium. VCAM-1 serves as a ligand for the leukocyte integrins α4β1 (CD49d/CD29 complex; VLA-4) and α4β7 (LPAM-1). The 51-10C9 monoclonal antibody inhibits the in vitro binding of lymphocytes and monocytes to VCAM-1 on stimulated endothelium.

940375 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940375 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940375" on CiteAb

Development References (6)

  1. Bevilacqua MP, Pober JS, Mendrick DL, Cotran RS, Gimbrone MA Jr. Identification of an inducible endothelial-leukocyte adhesion molecule. Proc Natl Acad Sci U S A. 1987; 84(24):9238-9242. (Biology). View Reference
  2. Cockerill GW, Rye KA, Gamble JR, Vadas MA, Barter PJ. High-density lipoproteins inhibit cytokine-induced expression of endothelial cell adhesion molecules. Arterioscler Thromb Vasc Biol. 1995; 15(11):1987-1994. (Clone-specific: Flow cytometry). View Reference
  3. Gamble JR, Bradley S, Noack L, Vadas MA. TGF-beta and endothelial cells inhibit VCAM-1 expression on human vascular smooth muscle cells. Arterioscler Thromb Vasc Biol. 1995; 15(7):949-955. (Immunogen: Flow cytometry). View Reference
  4. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  5. Taichman DB, Cybulsky MI, Djaffar I, et al. Tumor cell surface alpha 4 beta 1 integrin mediates adhesion to vascular endothelium: demonstration of an interaction with the N-terminal domains of INCAM-110/VCAM-1. Cell Regul. 1991; 2(5):347-355. (Biology). View Reference
  6. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
View All (6) View Less
940375 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.