Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD215 (IL-15Rα)

BD™ AbSeq Oligo Mouse Anti-Human CD215 (IL-15Rα)

Clone JM7A4 (also known as 7A4) (RUO)

560422
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
IL15RA; IL-15R-alpha; IL-15RA; IL-15Rα; CD215
3601
2 µl
Mouse BALB/c IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGTACTGATGTGGCGATATATAGACGAAACTGGGTG
AHS0212
Recombinant Human IL-15Rα Extracellular Domain
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940290 Rev. 2
Antibody Details
Down Arrow
JM7A4

The JM7A4 monoclonal antibody specifically binds to CD215, which is also known as the IL-15 Receptor alpha subunit (IL-15R-alpha, IL-15Ra, or IL-15Rα). This type I transmembrane glycoprotein is encoded by IL15RA (Interleukin 15 receptor subunit alpha) and is variably expressed on macrophages, natural killer (NK) cells, T cells and B cells and by some nonlymphoid cells including fibroblasts.  Although it can independently bind IL-15 with high affinity, it does not contain a signaling motif. CD215 (IL-15Rα) can present IL-15 in cis or trans fashion to the IL-2/15R beta (CD122) and IL-2R gamma (γc or CD132) receptor complex which can then transduce signals intracellularly. Several different CD215 (IL-15Rα) isoforms have been described that are produced by alternative splicing and may alter signal transduction responses to IL-15. A cleaved soluble form of CD215 known as sIL-15RA has also been reported which can bind and antagonize IL-15 activity. By binding to its heterotrimeric receptor, IL-15 plays crucial roles in innate immunity, eg, through the activation of NK cells and adaptive immunity, eg, in enhancing the survival of CD8+ memory T cells.

940290 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940290 Rev.2
Citations & References
Down Arrow

Development References (5)

  1. Dubois S, Mariner J, Waldmann TA, Tagaya Y. IL-15Ralpha recycles and presents IL-15 In trans to neighboring cells.. Immunity. 2002; 17(5):537-47. (Immunogen: Flow cytometry). View Reference
  2. Llinas L, Lazaro A, de Salort J, Matesanz-Isabel J, Sintes J, Engel P. Expression profiles of novel cell surface molecules on B-cell subsets and plasma cells as analyzed by flow cytometry. Immunol Lett. 2011; 134(2):113-121. (Clone-specific: Flow cytometry, Immunohistochemistry). View Reference
  3. Matesanz-Isabel J, Sintes J, Llinas L, de Salort J, Lazaro A, Engel P. New B-cell CD molecules. Immunol Lett. 2011; 134(2):104-112. (Clone-specific: Flow cytometry). View Reference
  4. Mortier E, Bernard J, Plet A, Jacques Y. Natural, proteolytic release of a soluble form of human IL-15 receptor alpha-chain that behaves as a specific, high affinity IL-15 antagonist.. J Immunol. 2004; 173(3):1681-8. (Biology). View Reference
  5. Vámosi G, Bodnár A, Vereb G, et al. IL-2 and IL-15 receptor alpha-subunits are coexpressed in a supramolecular receptor cluster in lipid rafts of T cells.. Proc Natl Acad Sci USA. 2004; 101(30):11082-7. (Clone-specific: Immunofluorescence). View Reference
940290 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.