Skip to main content Skip to navigation
Oligo Rat Anti-Mouse Vβ 6 T-Cell Receptor

BD™ AbSeq Oligo Rat Anti-Mouse Vβ 6 T-Cell Receptor

Clone RR4-7

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
TCR V beta 6; TCR Vβ6
100124684
2 µl
Rat F344, also known as Fischer, CDF IgG2b, λ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGAGATAAGTAAGGAGCGATTGCATAGAGGGTTGGC
AMM2185
C57BL/6 Mouse Helper T-Cell Clone OI11
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940427 Rev. 3
Antibody Details
Down Arrow Up Arrow
RR4-7

The RR4-7 antibody specifically reacts with the Vβ 6 T-Cell Receptor (TCR) of mice having the a (e.g., C57BR, C57L, SJL) and b (e.g., A, BALB/c, CBA/Ca, C3H/He, C57BL, DBA/1) haplotypes of the Tcrb gene complex. The Tcrb-V6 gene locus is deleted in mice having the c (e.g., RIII) haplotype. Vβ 6 TCR-bearing T lymphocytes are clonally eliminated in mice expressing superantigen encoded by Mtv-7 (Mls-1[a], Mls[a]) endogenous provirus (e.g., AKR, CBA/J, C58, DBA/2, NZB), or Mtv-43 endogenous provirus (e.g., MA/MyJ). Exogenous MMTV-SW, as well as endogenous Mtv-44-encoded superantigen (e.g., NZW), also causes incomplete elimination of Vβ 6 TCR-expressing T cells. Plate-bound RR4-7 antibody activates Vβ 6 TCR-bearing T cells, soluble RR4-7 mAb blocks in vitro proliferation and cytolytic activities of Vβ 6 TCR-bearing T-cell clones, and injection of the antibody results in in vivo depletion of Vβ 6 TCR-bearing T cells.

940427 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940427 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (14)

  1. Fairchild S, Rosenwasser OA, Dyson PJ, Tomonari K. Tcrb-V3+ T-cell deletion and a new mouse mammary tumor provirus, Mtv-44. Immunogenetics. 1992; 36(3):189-194. (Biology). View Reference
  2. Haqqi TM, Banerjee S, Anderson GD, David CS. RIII S/J (H-2r). An inbred mouse strain with a massive deletion of T cell receptor V beta genes. J Exp Med. 1989; 169(6):1903-1909. (Biology). View Reference
  3. Held W, Shakhov AN, Waanders G, et al. An exogenous mouse mammary tumor virus with properties of Mls-1a (Mtv-7). J Exp Med. 1992; 175(6):1623-1633. (Biology). View Reference
  4. Jones LA, Chin LT, Longo DL, Kruisbeek AM. Peripheral clonal elimination of functional T cells. Science. 1990; 250(4988):1726-1729. (Biology). View Reference
  5. Jones LA, Chin LT, Merriam GR, Nelson LM, Kruisbeck AM. Failure of clonal deletion in neonatally thymectomized mice: tolerance is preserved through clonal anergy. J Exp Med. 1990; 172(5):1277-1285. (Biology). View Reference
  6. Kanagawa O, Palmer E, Bill J. The T cell receptor V beta 6 domain imparts reactivity to the Mls-1a antigen. Cell Immunol. 1989; 119(2):412-426. (Immunogen). View Reference
  7. Kanagawa O. In vivo T cell tumor therapy with monoclonal antibody directed to the V beta chain of T cell antigen receptor. J Exp Med. 1989; 170(5):1513-1519. (Clone-specific). View Reference
  8. Kruisbeek AM, Shevach EM. Proliferative assays for T cell function. Curr Protoc Immunol. 2004; 3:3.12.1-3.12.14. (Clone-specific). View Reference
  9. Ramsdell F, Lantz T, Fowlkes BJ. A nondeletional mechanism of thymic self tolerance. Science. 1989; 246(4933):1038-1041. (Biology). View Reference
  10. Rocha B, Vassalli P, Guy-Grand D. The V beta repertoire of mouse gut homodimeric alpha CD8+ intraepithelial T cell receptor alpha/beta + lymphocytes reveals a major extrathymic pathway of T cell differentiation. J Exp Med. 1991; 173(2):483-486. (Biology). View Reference
  11. Rudy CK, Kraus E, Palmer E, Huber BT. Mls-1-like superantigen in the MA/MyJ mouse is encoded by a new mammary tumor provirus that is distinct from Mtv-7. J Exp Med. 1992; 175(6):1613-1621. (Biology). View Reference
  12. Tomonari K, Fairchild S. Positive and negative selection of Tcrb-V6+ T cells. Immunogenetics. 1992; 36(4):230-237. (Biology). View Reference
  13. Utsunomiya Y, Kosaka H, Kanagawa O. Differential reactivity of V beta 9 T cells to minor lymphocyte stimulating antigen in vitro and in vivo. Eur J Immunol. 1991; 21(4):1007-1011. (Clone-specific). View Reference
  14. Webb S, Morris C, Sprent J. Extrathymic tolerance of mature T cells: clonal elimination as a consequence of immunity. Cell. 1990; 63(6):1249-1256. (Biology). View Reference
View All (14) View Less
940427 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.