Skip to main content Skip to navigation
Oligo Rat Anti-Mouse F4/80-Like Receptor

BD™ AbSeq Oligo Rat Anti-Mouse F4/80-Like Receptor

Clone 6F12 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Fire; Emr4; EGF-like module receptor 4; D17Ertd479e; Egf-tm7
52614
2 µl
Rat IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGAATGGTTGAGGTTGCGGATAAGGTACTAAGCTGG
AMM2159
CHO cells expressing recombinant FIRE fusion protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940412 Rev. 2
Antibody Details
Down Arrow Up Arrow
6F12

The 6F12 antibody reacts with a 7-transmembrane-domain protein, which is similar to the F4/80 macrophage antigen of the EGF-TM7 protein family and is encoded by the Emr4 gene. The FIRE protein is expressed on myeloid cells with a denditic cell (DC) developmental potential, including subsets of DC and macrophages in the spleen and lymph nodes, most resident peritoneal macrophages, many peripheral blood monocytes, and a subpopulation of bone-marrow myeloid-cell progenitors. The protein is not detected on peripheral T and B lymphocytes, and it is down-regulated on thioglycollate-elicited peritoneal macrophages and on dendritic cells activated by GM-CSF, IFN-γ, anti-CD40, and LPS. Using soluble biotinylated fusion protein, a FIRE ligand was detected on a mouse IgG+ B lymphoma cell line (A20), but not on myeloid, fibroblast, or T-cell lines, suggesting that the FIRE protein may be involved in immunoregulatory interactions between antigen-presenting cells and B lymphocytes.

940412 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940412 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940412" on CiteAb

Development References (2)

  1. Caminschi I, Lucas KM, O'Keeffe MA, et al. Molecular cloning of F4/80-like-receptor, a seven-span membrane protein expressed differentially by dendritic cell and monocyte-macrophage subpopulations. J Immunol. 2001; 167(7):3570-3576. (Immunogen: Immunohistochemistry, Immunoprecipitation, Western blot). View Reference
  2. Stacey M, Chang GW, Sanos SL, et al. EMR4, a novel epidermal growth factor (EGF)-TM7 molecule up-regulated in activated mouse macrophages, binds to a putative cellular ligand on B lymphoma cell line A20. J Biol Chem. 2002; 277(32):29283. (Biology). View Reference
940412 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.